ID: 1118321716

View in Genome Browser
Species Human (GRCh38)
Location 14:64757362-64757384
Sequence AAGAGGAAACAGAAGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2378
Summary {0: 1, 1: 2, 2: 25, 3: 265, 4: 2085}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118321716_1118321722 4 Left 1118321716 14:64757362-64757384 CCACCTTTCTTCTGTTTCCTCTT 0: 1
1: 2
2: 25
3: 265
4: 2085
Right 1118321722 14:64757389-64757411 GGTGCCTGGCCCACATTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 185
1118321716_1118321728 20 Left 1118321716 14:64757362-64757384 CCACCTTTCTTCTGTTTCCTCTT 0: 1
1: 2
2: 25
3: 265
4: 2085
Right 1118321728 14:64757405-64757427 TCCTTGGCAGGGACATTCAGAGG 0: 1
1: 1
2: 1
3: 16
4: 200
1118321716_1118321725 9 Left 1118321716 14:64757362-64757384 CCACCTTTCTTCTGTTTCCTCTT 0: 1
1: 2
2: 25
3: 265
4: 2085
Right 1118321725 14:64757394-64757416 CTGGCCCACATTCCTTGGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 221
1118321716_1118321724 8 Left 1118321716 14:64757362-64757384 CCACCTTTCTTCTGTTTCCTCTT 0: 1
1: 2
2: 25
3: 265
4: 2085
Right 1118321724 14:64757393-64757415 CCTGGCCCACATTCCTTGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 219
1118321716_1118321720 -10 Left 1118321716 14:64757362-64757384 CCACCTTTCTTCTGTTTCCTCTT 0: 1
1: 2
2: 25
3: 265
4: 2085
Right 1118321720 14:64757375-64757397 GTTTCCTCTTAATGGGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118321716 Original CRISPR AAGAGGAAACAGAAGAAAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr