ID: 1118323805

View in Genome Browser
Species Human (GRCh38)
Location 14:64768517-64768539
Sequence CACAGCTCCTCCCTGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118323801_1118323805 -3 Left 1118323801 14:64768497-64768519 CCAGTTGGCCCTTCTTGGCTCAC 0: 1
1: 0
2: 0
3: 9
4: 201
Right 1118323805 14:64768517-64768539 CACAGCTCCTCCCTGAATGGTGG 0: 1
1: 0
2: 0
3: 24
4: 199
1118323799_1118323805 6 Left 1118323799 14:64768488-64768510 CCAGGGGCACCAGTTGGCCCTTC 0: 1
1: 0
2: 0
3: 16
4: 211
Right 1118323805 14:64768517-64768539 CACAGCTCCTCCCTGAATGGTGG 0: 1
1: 0
2: 0
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118323805 Original CRISPR CACAGCTCCTCCCTGAATGG TGG Intronic
900807281 1:4775801-4775823 CACATCCCCCCACTGAATGGTGG - Intronic
901012092 1:6207768-6207790 CACAACTCCACCCTGAATTGGGG - Intronic
901900593 1:12358514-12358536 CAGGGCTTCTCCCTGGATGGTGG + Exonic
903603427 1:24557982-24558004 CACAGCTCCTTCCTGACTTCAGG - Intronic
903847275 1:26285811-26285833 CACCGCTCCTACCTGTGTGGAGG + Exonic
904343089 1:29850782-29850804 CACAGCTCCACCCTGCAGAGGGG + Intergenic
904343512 1:29853279-29853301 CACAGCTCCACCCTGCAGAGGGG + Intergenic
905914069 1:41673069-41673091 CACAGCTTCTCCCAGGCTGGCGG + Intronic
907267680 1:53272658-53272680 CACAGCAACTCCATGACTGGGGG + Intronic
907305227 1:53509460-53509482 CTCAGCTCCGCCCTGCAGGGAGG + Intronic
915602143 1:156929221-156929243 CAGAGCCCCTTCCTCAATGGGGG - Intronic
917698793 1:177558661-177558683 CATTGTCCCTCCCTGAATGGAGG - Intergenic
919970126 1:202570853-202570875 CACAGCTCCTTGTTGCATGGAGG + Intronic
920563717 1:206957718-206957740 CCCTGCTCCTCCATGAATGTAGG + Intergenic
921351563 1:214241517-214241539 CCCATGTCCTCCCTGAATGGAGG - Intergenic
921526186 1:216221365-216221387 CACAGCTCCTCTGTTAATCGGGG - Intronic
921985059 1:221303649-221303671 CACAGCTGCTCCCGGTGTGGAGG + Intergenic
923407301 1:233674884-233674906 CACAGCTCTTCCCAGCATGGAGG - Intergenic
923864746 1:237927463-237927485 CACAGCTTCTCCCTGATGTGGGG - Intergenic
1062829545 10:596631-596653 CACAGTTCCTCCCTGACAGAAGG + Intronic
1064191397 10:13208978-13209000 AACAGCTTCTCCTTGAATGGGGG + Intronic
1065110670 10:22437055-22437077 CTCAGCTCCTCCCGGCACGGCGG - Intronic
1067475307 10:46561099-46561121 CACTGCTCTTCCCAAAATGGTGG + Intergenic
1075715932 10:124555360-124555382 CACAGCTCCTCCCTGGAGGAAGG + Intronic
1076266141 10:129111140-129111162 CACAGCTCCTCCCTAACGGTGGG - Intergenic
1077216993 11:1399076-1399098 CCCAGCTCCTTCCTGGCTGGAGG - Intronic
1079338194 11:19589695-19589717 CACAGCCCCTTTCAGAATGGGGG + Intronic
1079375649 11:19889370-19889392 CATAGATTCTCTCTGAATGGTGG + Intronic
1081591910 11:44429332-44429354 CACAGCACATCCCTGTAGGGTGG - Intergenic
1081866905 11:46365181-46365203 CACAGCTCCTGCCTGCCTGCAGG + Intronic
1084377958 11:68791328-68791350 CACAGTGTCTCCCTGATTGGAGG - Intronic
1085063821 11:73473693-73473715 CACAGCTCCTCACTTAATTCAGG + Intronic
1086966516 11:93033388-93033410 TACTGCTCTTCCCTGAATGGTGG - Intergenic
1087975822 11:104545020-104545042 CTCACCACCTCCCTGGATGGGGG + Intergenic
1088186604 11:107177532-107177554 CCCAGCTCCTCCTTGTACGGGGG - Intergenic
1091095736 11:132820577-132820599 CACATCTTCTCCCTGAATGAGGG - Intronic
1092413821 12:8274481-8274503 CACCTCCCCTCCCTGAGTGGTGG + Intergenic
1096567944 12:52496736-52496758 GACAGCTCCCACCTGAAGGGAGG - Intergenic
1097978045 12:65708993-65709015 CAAAACTCCTCCCAGACTGGTGG + Intergenic
1100237509 12:92675239-92675261 CACAGGTCCTTCCTGATTGTTGG - Intergenic
1100302261 12:93318717-93318739 CACGGCTGCTCTCTAAATGGCGG - Intergenic
1102195649 12:111023455-111023477 CACAGGTGCCCCCTGAATGCAGG - Intergenic
1102626909 12:114242390-114242412 CACAGCTCCTCCCTGCCTTAGGG + Intergenic
1103878908 12:124150841-124150863 CTCAGCTCCTCCCTGGTTGTTGG - Intronic
1105439205 13:20401965-20401987 CACAGTTCCGCCCTGCATGCTGG + Intergenic
1105668645 13:22588293-22588315 CACAATTCCTCCCTGAATGCAGG + Intergenic
1107989069 13:45801354-45801376 CACAGCTCCTCCCTGCATTCAGG - Intronic
1113940113 13:114014614-114014636 CCCAGCTCCTCCCTGAGGGTCGG + Intronic
1114343403 14:21769173-21769195 CACAGCTCCTGACAGAATGGGGG + Intergenic
1115740735 14:36385157-36385179 CTCAGCTCATCCCAGAAGGGAGG - Intergenic
1118323805 14:64768517-64768539 CACAGCTCCTCCCTGAATGGTGG + Intronic
1120824770 14:88945226-88945248 CAAATGGCCTCCCTGAATGGGGG + Intergenic
1121047207 14:90796770-90796792 GCCAACTCCTCCCTGAATAGCGG - Intronic
1121049503 14:90811305-90811327 CCCAACTCCTCCCAGAATGTGGG - Intronic
1121087160 14:91155373-91155395 CACAGTACCTCACTGAGTGGTGG - Intronic
1122812415 14:104295615-104295637 CCCAGCAGCTCCCTGGATGGTGG + Intergenic
1124214584 15:27796136-27796158 CACATCTACTCTCTGACTGGAGG + Intronic
1124263881 15:28216456-28216478 CTCCACTACTCCCTGAATGGAGG + Intronic
1124314193 15:28653604-28653626 CTCCACTACTCCCTGAATGGAGG - Intergenic
1126339968 15:47629000-47629022 CAAAGGTGCTCCCTCAATGGAGG - Intronic
1126908828 15:53397600-53397622 CACAGCTCCTACATGAAGGTTGG + Intergenic
1128080456 15:64854097-64854119 AAAAGCTCCTCCCTCAGTGGTGG - Intronic
1131108421 15:89749962-89749984 CTCAGCCCCTCCCTCCATGGAGG - Exonic
1131147047 15:90020788-90020810 TCCCTCTCCTCCCTGAATGGCGG + Intronic
1135305013 16:21360264-21360286 CACCGCCCCTCCCTGAGTGCTGG - Intergenic
1139949786 16:70663274-70663296 CTCAGCTCCTCCTGGAATGCTGG - Exonic
1140232144 16:73126164-73126186 CCCAGAGCCTCCCAGAATGGAGG - Intergenic
1142063451 16:88046016-88046038 CACCGCCCCTCCCTGAGTGCTGG - Intronic
1142591546 17:1008342-1008364 CACAGCTCCTGCCTGGAGGGTGG - Intronic
1147423590 17:40334658-40334680 CACTGCTCCTGCAGGAATGGAGG - Intronic
1148172658 17:45536191-45536213 CAAAGTCCCTCACTGAATGGGGG - Intergenic
1148276612 17:46309258-46309280 CAAAGTCCCTCACTGAATGGGGG + Intronic
1148298729 17:46526846-46526868 CAAAGTCCCTCACTGAATGGGGG + Intronic
1148363263 17:47031343-47031365 CAAAGTCCCTCACTGAATGGGGG + Intronic
1148780320 17:50117733-50117755 CCCAGCTCCTCCGGGAAGGGAGG - Intronic
1150403863 17:64883111-64883133 CAAAGCCCCTCACTGAATGGGGG - Intronic
1150879819 17:69011665-69011687 CACATCTCATCTCTCAATGGTGG - Intronic
1151183043 17:72343473-72343495 CACCCCTCCTCTCTGCATGGTGG - Intergenic
1152445764 17:80342134-80342156 CACAGCTCCCCACTGTATGTAGG + Intronic
1152775597 17:82199779-82199801 GTCAGCTTCTCCCTGAGTGGAGG - Intronic
1156516761 18:37686772-37686794 CACAGATCCTCCCAGGAGGGTGG + Intergenic
1157042993 18:44061614-44061636 CACAGCTTCACCCAGAAGGGTGG + Intergenic
1157575767 18:48742064-48742086 CACAGCTCATCCCTGGAGGCAGG - Intronic
1157601038 18:48893478-48893500 CCCAGTACCTCCCTGAAGGGAGG + Intergenic
1159849621 18:73512204-73512226 TACAACTCCTCCCTAAATGATGG - Intergenic
1160017347 18:75154838-75154860 AACAGCTTCTCCCTGACAGGCGG + Intergenic
1161028976 19:2049338-2049360 CACGGCTGCTCCCTGGATTGGGG - Intronic
1162039602 19:7962190-7962212 TACGACTCCTCCCTGAATGCTGG + Exonic
1163378982 19:16951918-16951940 CCCAACTCCCCACTGAATGGAGG + Intronic
1165470028 19:35997859-35997881 CACAGCTCCTCCCTCAAATCAGG - Intergenic
1165533767 19:36425877-36425899 CACTGCTGTTCCCTGAAGGGTGG - Intergenic
1165832041 19:38735199-38735221 CACAGCTCCTCCCTGCCTCAGGG - Intronic
1165979398 19:39706998-39707020 CACAGCATCTCCCTGCCTGGGGG + Intronic
1166303196 19:41923639-41923661 CACCGCCCCTCCCTGCATGCTGG - Intronic
925356330 2:3244074-3244096 CAGAGCTCCTCCCAGGATGCAGG + Intronic
926605283 2:14891723-14891745 CACAGCTGCTCACTGATTGAGGG - Intergenic
927495687 2:23550104-23550126 CACAGCTCCTGCCTTCAGGGAGG - Intronic
928266529 2:29816791-29816813 CACAGCTCCTCCCAGCCTGACGG + Intronic
928398520 2:30961512-30961534 AGCAGCTGCTCTCTGAATGGTGG + Intronic
930349263 2:50228852-50228874 CAGAGCACAGCCCTGAATGGGGG - Intronic
931723354 2:65083774-65083796 CCTTTCTCCTCCCTGAATGGAGG + Exonic
932101826 2:68908287-68908309 CAGAGCTGCTTCCTGAAGGGTGG + Intergenic
933001400 2:76928458-76928480 CAAAGCTCCTCCGTGGATAGTGG - Intronic
933837908 2:86260575-86260597 CAGAGATCCTCCCTAACTGGTGG + Intronic
935782724 2:106522042-106522064 CAAAGATCTTCCCTGAATGTGGG - Intergenic
939045012 2:137239679-137239701 CCCAACTCCTCCCAGAATGTTGG + Intronic
941473424 2:165918684-165918706 CAGAGCTCCTCCATGACTTGAGG + Intronic
941543443 2:166815716-166815738 CCCATCTCCTCCCAGAATGTTGG - Intergenic
942393061 2:175516507-175516529 CCCAGCTCCTCCAGTAATGGAGG - Intergenic
948153561 2:235764316-235764338 CACAGCTCTTCCCTGAAAATCGG - Intronic
948896129 2:240928539-240928561 CACAGCCTCTTCCTGAATGCAGG - Intronic
1173591928 20:44231503-44231525 CACAGGTTCTCCCTGAAAGAAGG + Intergenic
1174912535 20:54622490-54622512 CACAGCTCCTCCCTGGAGCTGGG + Intronic
1175271901 20:57739986-57740008 CTCAGCTCCTCACTGGATGTTGG - Intergenic
1178256165 21:31054333-31054355 CACAGCATTTCCCTGGATGGAGG - Intergenic
1178497687 21:33101302-33101324 CACAGCTCCTCCTTGGAGGTGGG + Intergenic
1178944985 21:36939585-36939607 GACAGTTCCTCCCTGTAAGGAGG + Intronic
1179618678 21:42598368-42598390 CTCTGCCCCTCTCTGAATGGGGG + Intergenic
1180830255 22:18902012-18902034 CACAGCTCTTGCCTAAGTGGTGG - Intergenic
1181523050 22:23460262-23460284 CACAGCTCCTCCAGCCATGGGGG - Intergenic
1181769258 22:25113502-25113524 CAGGGCTCCTCCCTAAATGCTGG - Intronic
1183618673 22:38960148-38960170 CCCAGCTCCTCCCCAAATGCTGG - Intronic
1183665966 22:39245803-39245825 CACAGCAGCTCCCTGACTGGGGG - Intergenic
1184652828 22:45926922-45926944 CACAGCCCTTCCCTGACTGAGGG - Intronic
1203280344 22_KI270734v1_random:127283-127305 CACAGCTCTTGCCTAAGTGGTGG - Intergenic
950715627 3:14845835-14845857 CTCAGGTCCTCCCTGACTAGTGG + Intronic
951168175 3:19507168-19507190 CTGAGCTCCTCTCTGTATGGTGG + Intronic
954610850 3:51943846-51943868 CACAGCTGGGCCCTGGATGGGGG - Intronic
956166317 3:66400711-66400733 CCCAGCCCCTTCCTGAAAGGAGG + Intronic
960124164 3:113980011-113980033 CACAGTTCCTCCCTGTAGAGTGG + Intronic
960972816 3:123151580-123151602 TTCAGCTCCTCCCTGACTGAGGG + Intronic
961294593 3:125874375-125874397 CACCTCCCCTCCCTGAGTGGTGG - Intergenic
961465788 3:127080740-127080762 CTCAGCTCCTCCCTCAAAGCTGG - Intergenic
961891372 3:130133102-130133124 CACCTCCCCTCCCTGAGTGGTGG + Intergenic
962996784 3:140636677-140636699 CAGGGCTGCTCCCTGAATAGGGG + Intergenic
963221809 3:142821205-142821227 CACAGCTCCAACCTGAATTTTGG - Intronic
966548417 3:181178120-181178142 CACCGCTCTTCTCTGGATGGAGG + Intergenic
966971123 3:185046443-185046465 CCCACCTCTTCCCTGGATGGTGG + Intronic
967621773 3:191642508-191642530 GACTGCTCCTCTCTGTATGGTGG - Intergenic
968525008 4:1052286-1052308 CACAGCTGCACCGTGAGTGGTGG + Intergenic
968923811 4:3536498-3536520 CAAAGACCCTCCCTGAATGCTGG - Intergenic
969811170 4:9649267-9649289 CACCTCCCCTCCCTGAGTGGTGG - Intergenic
970279157 4:14435114-14435136 CACATCTCATCCCTAAATTGCGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
972828335 4:42786861-42786883 CAGAGCTCTTCTCTGTATGGTGG + Intergenic
978379417 4:108111436-108111458 CACAACTCCTGCCTGAAGGGAGG + Intronic
981047028 4:140274575-140274597 CACAGCTGCTGGCTGAAGGGAGG - Intronic
984087593 4:175331616-175331638 CACAGCTCCTGCAGGAATGTTGG - Intergenic
985716945 5:1468022-1468044 CGCAGCCCCTCCCTGAAGAGAGG - Intronic
988736845 5:34031130-34031152 CACAGCTCATTCTTCAATGGTGG - Intronic
989232267 5:39100057-39100079 CAGAGCTTCACCCTAAATGGTGG - Intergenic
991125673 5:63067158-63067180 CACAGTTCTTCACTAAATGGAGG - Intergenic
992096166 5:73364996-73365018 GACAGCTCCTCTCTGAATGAGGG - Intergenic
992960388 5:81952701-81952723 CACTGCTCCTGCCTTATTGGAGG - Intergenic
994124053 5:96150413-96150435 CACAGCTCCTCCCTGCAGTGAGG - Intergenic
997413152 5:133705430-133705452 CACACCTCCTTCTGGAATGGTGG + Intergenic
997675881 5:135712910-135712932 TACAGAGCCTCCCTGAATGGTGG - Intergenic
998152151 5:139763642-139763664 CCCTGCTCCTCTCGGAATGGAGG + Intergenic
999249432 5:150173354-150173376 CTCTGCTCCTCCCTGCCTGGGGG + Intronic
1001044804 5:168363563-168363585 CCCAGCTCCTCCAGGAAGGGAGG + Intronic
1001554294 5:172625572-172625594 CCCAGCTCCCCTCTGAGTGGGGG + Intergenic
1002061059 5:176626470-176626492 CACAGCTCCTCCCAGATGTGAGG + Exonic
1002176836 5:177405397-177405419 CACAGCCCCTGCCAGAAAGGAGG - Exonic
1002520779 5:179792427-179792449 CACAGGGCCTGCCTGAAGGGTGG - Intronic
1004843310 6:19612183-19612205 CACAGTTCTTCCATAAATGGAGG - Intergenic
1006603977 6:35243483-35243505 CAGAGATTCTCCCTGAATCGGGG + Intronic
1006639752 6:35483808-35483830 CACAGCTCTTTCCTGCCTGGGGG + Intronic
1007619508 6:43203477-43203499 CACAGCTGCTCCCGGAACAGTGG - Exonic
1007728305 6:43930191-43930213 CACAGCTCCACCCCTAAGGGTGG - Intergenic
1012559842 6:100567179-100567201 CACAGATCATCTCTGAGTGGTGG - Intronic
1017727538 6:157285920-157285942 CAATGCTGCTCCCTGATTGGAGG + Intergenic
1018390012 6:163335124-163335146 CACAGCATCTCCCTGCATGTGGG - Intergenic
1022016175 7:26350326-26350348 CCCATCTCCTCCCTCAGTGGTGG - Intronic
1024962348 7:54990889-54990911 CCCAGATCCTCTCAGAATGGAGG - Intergenic
1026988698 7:74570930-74570952 CACAGCTCCTCCCTGCGTATGGG + Intronic
1027186121 7:75971823-75971845 CACACCCCCTCCCTGCATGGTGG - Intronic
1028472967 7:91224418-91224440 CCCAGATCCTCCCTGAACTGTGG - Intergenic
1029344299 7:99967269-99967291 CACAGATCCTCCCTCTGTGGTGG - Exonic
1029347194 7:99987253-99987275 CACAGATCCTCCCTCTGTGGTGG + Intergenic
1029507283 7:100969915-100969937 CACAGCTCCTGGCTGAGGGGCGG + Intronic
1030107677 7:106000291-106000313 CAGAGCTCCTCCCTGGATCCAGG - Intronic
1033483573 7:141765281-141765303 CACAGCCTCTCTCTGTATGGTGG + Intronic
1033861444 7:145632834-145632856 CCCATGTGCTCCCTGAATGGAGG - Intergenic
1034697081 7:153063356-153063378 CACTGCTTCTTCCTGCATGGAGG - Intergenic
1034900982 7:154907667-154907689 CCCTGCTCCTCCCTCCATGGGGG - Intergenic
1035230106 7:157460175-157460197 CACAGTGCCTCTCAGAATGGAGG + Intergenic
1036102630 8:5803376-5803398 CACAACTGCTCCCTGAAAGGGGG - Intergenic
1036581873 8:10082394-10082416 CACAGCTTCTCCCTGCTTGAGGG + Intronic
1037745590 8:21641716-21641738 CTCTTCTCCTCCCTGAAAGGGGG + Intergenic
1039238314 8:35527293-35527315 CAGAGCTCCTTCCTGAAAGATGG + Intronic
1041068047 8:54101527-54101549 CCCAGCTCCTCCCTGCATTGCGG - Intronic
1041110377 8:54477486-54477508 CACAGTGCCTGCCTGAATGATGG + Intergenic
1042230860 8:66552970-66552992 CACAGCTCCCCCCAGAAAGATGG - Intergenic
1042243720 8:66690156-66690178 CACAGGTCCTCACTGACTGTCGG + Intronic
1043275580 8:78388403-78388425 AGCAGCTCCTCCCTAAATGGTGG + Intergenic
1047004464 8:120605308-120605330 CACAGCTTGTCTCTGAAAGGAGG + Intronic
1049242379 8:141544544-141544566 CACAGCTGCTCTCTGCAGGGCGG - Intergenic
1049446420 8:142633538-142633560 CACAGCTCCACACTGACTGAGGG - Intergenic
1049504715 8:142989950-142989972 CACAGCACGTCCATGCATGGGGG + Intergenic
1051131240 9:13863289-13863311 CACAGTTCCACACTGAGTGGTGG + Intergenic
1051756570 9:20407405-20407427 CACAGCTCTTCCCTCAATCCTGG + Intronic
1053289002 9:36867883-36867905 CAGATGTCCTCCCTGAATGCGGG - Intronic
1053424545 9:38002563-38002585 CACAACTGTCCCCTGAATGGTGG - Intronic
1053430929 9:38041299-38041321 CACAGCCCCCGCCTGACTGGTGG - Intronic
1053799523 9:41755521-41755543 CAAAGACCCTCCCTGAATGCTGG - Intergenic
1054145692 9:61559476-61559498 CAAAGACCCTCCCTGAATGCTGG + Intergenic
1054187933 9:61967582-61967604 CAAAGACCCTCCCTGAATGCTGG - Intergenic
1054650582 9:67620999-67621021 CAAAGACCCTCCCTGAATGCTGG + Intergenic
1056558437 9:87709193-87709215 CTCAGCTCCTTCCTGAGTGTTGG + Intergenic
1058481297 9:105398102-105398124 CACAGCTACTGCCTAAATGATGG - Intronic
1059442530 9:114317050-114317072 CACAGCTCCGCTTTGAATGGTGG + Intergenic
1060211721 9:121714682-121714704 CCCAGCTCCTCCCCTAGTGGAGG + Intronic
1060398102 9:123330390-123330412 CCCAACTCCTCCAGGAATGGTGG + Intergenic
1060470014 9:123940755-123940777 CCCAGCTCCTTCCTTCATGGAGG - Intergenic
1060652121 9:125337284-125337306 CACAGCTCCTTCCAGGATTGGGG - Exonic
1062571781 9:137189059-137189081 CACAGCTCCTCTATGCCTGGGGG - Exonic
1188693123 X:33155087-33155109 CACAGCTCTACCCTGATTTGTGG + Intronic
1188891981 X:35622827-35622849 CAAGACTGCTCCCTGAATGGGGG + Intergenic
1191006054 X:55712506-55712528 CACAGCTGCTGCCAGAATTGGGG - Intergenic
1194349432 X:92808258-92808280 CACTCCTCCTCCCTTAAGGGTGG + Intergenic
1198889562 X:141377857-141377879 CACTGCTCCACCCTGAAGGGAGG + Intergenic
1200116954 X:153773635-153773657 CACAGCTCCTCCTTGGCTGTGGG - Exonic
1200657756 Y:5924859-5924881 CACTCCTCCTCCCTTAAGGGTGG + Intergenic
1201621419 Y:15962869-15962891 CACATCTCCCTCCTGAATGGTGG - Intergenic