ID: 1118325822

View in Genome Browser
Species Human (GRCh38)
Location 14:64779724-64779746
Sequence CCGGGACTTAGAGGATGAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118325822_1118325825 -7 Left 1118325822 14:64779724-64779746 CCGTCTCATCCTCTAAGTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 242
Right 1118325825 14:64779740-64779762 GTCCCGGCTGATCTGCAGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 121
1118325822_1118325828 -1 Left 1118325822 14:64779724-64779746 CCGTCTCATCCTCTAAGTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 242
Right 1118325828 14:64779746-64779768 GCTGATCTGCAGCTTGGCTCTGG 0: 1
1: 0
2: 0
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118325822 Original CRISPR CCGGGACTTAGAGGATGAGA CGG (reversed) Exonic