ID: 1118325822 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:64779724-64779746 |
| Sequence | CCGGGACTTAGAGGATGAGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 257 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 13, 4: 242} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1118325822_1118325825 | -7 | Left | 1118325822 | 14:64779724-64779746 | CCGTCTCATCCTCTAAGTCCCGG | 0: 1 1: 0 2: 1 3: 13 4: 242 |
||
| Right | 1118325825 | 14:64779740-64779762 | GTCCCGGCTGATCTGCAGCTTGG | 0: 1 1: 0 2: 2 3: 10 4: 121 |
||||
| 1118325822_1118325828 | -1 | Left | 1118325822 | 14:64779724-64779746 | CCGTCTCATCCTCTAAGTCCCGG | 0: 1 1: 0 2: 1 3: 13 4: 242 |
||
| Right | 1118325828 | 14:64779746-64779768 | GCTGATCTGCAGCTTGGCTCTGG | 0: 1 1: 0 2: 0 3: 16 4: 177 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1118325822 | Original CRISPR | CCGGGACTTAGAGGATGAGA CGG (reversed) | Exonic | ||