ID: 1118328493

View in Genome Browser
Species Human (GRCh38)
Location 14:64797659-64797681
Sequence CCCGATAAGGACACAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118328493_1118328497 21 Left 1118328493 14:64797659-64797681 CCATTCACTGTGTCCTTATCGGG 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1118328497 14:64797703-64797725 ATGCATAACGGAAAATGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 128
1118328493_1118328496 9 Left 1118328493 14:64797659-64797681 CCATTCACTGTGTCCTTATCGGG 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1118328496 14:64797691-64797713 AATCTACTGTCAATGCATAACGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118328493 Original CRISPR CCCGATAAGGACACAGTGAA TGG (reversed) Intronic
901754463 1:11432980-11433002 CCCAATAAGGTCACAGTAATTGG + Intergenic
904344462 1:29858985-29859007 CCAGACAAGGACACTGTGAAAGG - Intergenic
904864633 1:33568724-33568746 CCCATTAAGGACACAGTCACAGG - Intronic
906262469 1:44404963-44404985 CCCGCAAAGGTCTCAGTGAATGG - Intergenic
906730012 1:48072691-48072713 CCAGATAAGGAACCAGAGAAAGG - Intergenic
907185925 1:52609140-52609162 CCCAATAAGAACTCAGTGACCGG + Intergenic
908453908 1:64283313-64283335 CCCAAGAAGGACACAGAAAAGGG - Intergenic
909837347 1:80273695-80273717 CCATGTGAGGACACAGTGAAAGG + Intergenic
915489040 1:156241430-156241452 CCTGCTAAGGACACAGGGAAGGG + Intronic
917018481 1:170560861-170560883 CCACATGAGGACATAGTGAAAGG + Intergenic
920567556 1:206987127-206987149 CCCGACAAGGACAGGGTGAGGGG - Intergenic
1066703741 10:38156632-38156654 CCCTATCAGGACCCAGTGAGAGG - Intergenic
1068475026 10:57513850-57513872 CCCGTTCAGGACACAGGGTAGGG + Intergenic
1073045300 10:100634250-100634272 CCCGCTAAGGACAAGGTGAAGGG - Intergenic
1074140344 10:110666964-110666986 CCCAATAAGGCCACAGTGGGAGG - Intronic
1076896651 10:133316535-133316557 CCCGCTTAGGACACAGAGATAGG + Intronic
1078277806 11:9867395-9867417 GCCGGTAAGGACACAGAGAATGG + Intronic
1080086041 11:28283524-28283546 TCTAATAAGTACACAGTGAATGG + Intronic
1080383221 11:31795777-31795799 GCCTGTAAGGCCACAGTGAAGGG + Intronic
1080777287 11:35397753-35397775 CCAGGTCAGGACACAGTGAGAGG + Intronic
1081789275 11:45771549-45771571 CCCCATAAGGAAACAGGGCAGGG - Exonic
1084450223 11:69232382-69232404 CCAGATAAGGTCACAGTCAAAGG - Intergenic
1085226674 11:74927557-74927579 CCCAGTAGGGACACAGTAAATGG - Intronic
1089958979 11:122599098-122599120 CCCAGGAAGGACACAGAGAAGGG + Intergenic
1090060279 11:123458661-123458683 CTAGATAAGGAAACAGTGAAAGG + Intergenic
1093253405 12:16836399-16836421 TCCAATAAGGATACAGGGAAAGG - Intergenic
1098281767 12:68869196-68869218 GCTGATAAGGACAGAGTGAAGGG + Intronic
1099603532 12:84772037-84772059 CTTGATAAGTTCACAGTGAAAGG - Intergenic
1101541719 12:105671492-105671514 CCAGATAAGGACAGACTGTAGGG + Intergenic
1106316743 13:28600921-28600943 TCCATTAAGTACACAGTGAAAGG - Intergenic
1110858355 13:80321251-80321273 CCTGTTCAGGAGACAGTGAATGG - Intergenic
1113479331 13:110608901-110608923 CCCGATAAGGACTCCCTCAAGGG - Intergenic
1114603632 14:23977202-23977224 CCAGAAAAGAAAACAGTGAATGG - Intronic
1114608643 14:24019976-24019998 CCAGAAAAGAAAACAGTGAATGG - Intergenic
1118328493 14:64797659-64797681 CCCGATAAGGACACAGTGAATGG - Intronic
1120229367 14:81826313-81826335 CCATAGAAGGACACTGTGAATGG - Intergenic
1125396595 15:39255451-39255473 TCAGGTAAGGACACAGTAAAAGG + Intergenic
1126983389 15:54273332-54273354 GGAGATAGGGACACAGTGAAAGG - Intronic
1130960383 15:88655034-88655056 CCAGCTAGGGACACAGGGAAGGG - Intronic
1135105011 16:19641735-19641757 CCTGTTAAGAACACAGTGACAGG + Intronic
1135948531 16:26888865-26888887 CCCGATAAGGACAAAATGATGGG - Intergenic
1138986496 16:62335151-62335173 CCCAGAAAGGAGACAGTGAAAGG + Intergenic
1141701780 16:85645670-85645692 CCCACTCCGGACACAGTGAAGGG + Intronic
1147211405 17:38874479-38874501 CCCAAAAAGGACACAGTGGAAGG + Intronic
1151474041 17:74335451-74335473 CCCGATAGGGACACAGCTTATGG + Intronic
1152792351 17:82288184-82288206 CCACATGAGGACACAGGGAAAGG + Intergenic
1153379848 18:4426074-4426096 CACTATAAAAACACAGTGAAAGG + Intronic
1155740747 18:29284909-29284931 CCTTGTGAGGACACAGTGAAAGG + Intergenic
1157397634 18:47356001-47356023 GCCGATGAGGACACTGTGAGAGG + Intergenic
1158425878 18:57339241-57339263 TCCTATAAGGACACAGTCATTGG + Intergenic
1160079814 18:75714774-75714796 CCATATAAGGACATAGTGACAGG - Intergenic
1161268216 19:3374991-3375013 CCCGGAAAGGGCACAGAGAAGGG + Intronic
1166637830 19:44467421-44467443 CCATGTAAGGACACAGTGAGAGG + Intergenic
930409058 2:51000267-51000289 CAGGATAAGGACATAGAGAATGG - Intronic
933386148 2:81613071-81613093 CGGAATGAGGACACAGTGAAAGG - Intergenic
934464233 2:94244699-94244721 CCAGAGAAGGACAGAGGGAAAGG - Intergenic
937244840 2:120486000-120486022 CACTATGAGGCCACAGTGAATGG - Intergenic
937887908 2:126912681-126912703 CCCCATAAGGACCCAGTCAGAGG + Intergenic
938544154 2:132312639-132312661 CCATGTAAGGACACAGTGAGAGG + Intergenic
940629376 2:156218302-156218324 CCATGTAAGGACACAGTGAAAGG + Intergenic
946211186 2:218148684-218148706 CCAGATGAAGACACAGGGAAGGG + Intergenic
948265059 2:236629891-236629913 CCCAATAAGGTCACAGTCAGGGG + Intergenic
1170230716 20:14043953-14043975 CACGATAAGGCTTCAGTGAAAGG + Intronic
1171873017 20:30545371-30545393 CCATGTAAGGACACAGTGAGAGG + Intergenic
1175547062 20:59785218-59785240 CCCTATAAAGACACAGAGAGAGG - Intronic
1180195604 21:46191787-46191809 CCCAAAAAGGACACAGAGCAGGG + Intronic
1181829434 22:25547852-25547874 CGCCATAAGGACTCAGTAAATGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184956365 22:47889454-47889476 CCACATGAGGACACAGTGAGAGG - Intergenic
1185368523 22:50447812-50447834 CCCAGAAAGGAGACAGTGAAGGG + Intronic
954365545 3:50144279-50144301 CCCGCTAGGGAGACAGGGAAAGG + Intergenic
958680560 3:97325346-97325368 ACCAGTGAGGACACAGTGAAAGG - Intronic
962216526 3:133527074-133527096 CCAGATCAGGACACAGAGAGGGG - Intergenic
962752346 3:138442878-138442900 GCTGATAAGACCACAGTGAATGG - Intronic
963008118 3:140745220-140745242 CCCAATAAATACACATTGAATGG - Intergenic
964291482 3:155185698-155185720 CCAGATGAGGATACAGTGTATGG + Intergenic
967049772 3:185771936-185771958 CCAGATATGGCCACAGTGACAGG - Intronic
967373473 3:188774729-188774751 CCATGTAAGGACACAGTGAGAGG - Intronic
967976849 3:195040344-195040366 CCCGTTCTGGGCACAGTGAAAGG - Intergenic
968801443 4:2745768-2745790 CGGGATAAGGACAGTGTGAAAGG - Intronic
968863046 4:3187826-3187848 CGCTAGAAGAACACAGTGAAGGG + Exonic
972612999 4:40672403-40672425 CAGGATAAGGAGACAGTGACGGG + Intergenic
976467576 4:85388182-85388204 CCATGTGAGGACACAGTGAAAGG + Intergenic
981540495 4:145841722-145841744 CCCGATGAGGACACAAACAAGGG + Intronic
982205068 4:152991568-152991590 CCTGAAAAGGACACAGGGCAGGG + Intergenic
983314135 4:166105735-166105757 CCCAGAAAGGACAAAGTGAAAGG + Intergenic
987968483 5:24909235-24909257 CCATATGAGGACACAGTGAAAGG - Intergenic
991654562 5:68891306-68891328 CCTGTTAAGGACACAGCAAAAGG - Intergenic
993051522 5:82931623-82931645 TCCTTTAAGGAAACAGTGAAAGG - Intergenic
994065325 5:95533755-95533777 TCTGATAAAGACATAGTGAAGGG - Intronic
996039961 5:118798323-118798345 CCATGTAAGGATACAGTGAAAGG + Intergenic
999840340 5:155418322-155418344 CCACATAAGGACACAGCAAAAGG - Intergenic
1002856614 6:1043639-1043661 CCCGATAATTACACAAAGAAAGG - Intergenic
1004096377 6:12558967-12558989 CCCAAAAGGGAAACAGTGAACGG + Intergenic
1010373824 6:75142823-75142845 CTAGAGAAGGACACAGAGAAAGG - Intronic
1011497467 6:87950596-87950618 CCTGAAATGAACACAGTGAAGGG - Intergenic
1011841063 6:91499552-91499574 CCATATGAGGACACAGTGTAAGG - Intergenic
1012634134 6:101514412-101514434 CCCCATATGGAGACAGGGAAGGG + Intronic
1014730935 6:125030844-125030866 CCCAATAGGGACACTGTGTAGGG + Intronic
1018398989 6:163403652-163403674 CACGATGAGGACAGAGAGAATGG + Intergenic
1028730836 7:94146788-94146810 CCTGATCCAGACACAGTGAAGGG - Intergenic
1028805085 7:95016883-95016905 CCAGATAAGAATACATTGAAAGG - Intronic
1030356979 7:108553986-108554008 CCCAATAAGGGCAGAATGAATGG + Intronic
1031996596 7:128236101-128236123 GCAGATCAGTACACAGTGAAGGG - Intergenic
1034404716 7:150895728-150895750 CCAAATAAGGTCACAGTGATAGG - Intergenic
1034945024 7:155256359-155256381 CCACGTAAGGACACAGTGAGAGG + Intergenic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1037621269 8:20565665-20565687 GCCGGTAAGTAGACAGTGAATGG + Intergenic
1038473235 8:27843219-27843241 CCACATAGGGACACAGCGAAAGG + Intergenic
1038686329 8:29721903-29721925 CCCCAAAAGGAAACAGTGCAAGG - Intergenic
1040642939 8:49361536-49361558 GCTGATAAGGACACAGAGAAAGG - Intergenic
1040643059 8:49363137-49363159 GCTGATAAGGACACAGAGAAAGG - Intergenic
1042223199 8:66493732-66493754 CACGTTAAGGAAACAGTCAAGGG - Intronic
1046026598 8:108731239-108731261 CAAAAAAAGGACACAGTGAAGGG + Intronic
1047999934 8:130370360-130370382 CCATATAAGGACACAATGAGAGG + Intronic
1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG + Intergenic
1057236250 9:93364224-93364246 CCCGATGAGGACACAGTGAGTGG - Intergenic
1057287921 9:93775240-93775262 CCACGTGAGGACACAGTGAAAGG + Intergenic
1058578243 9:106426180-106426202 CCTGAGAAGGACAAGGTGAAGGG + Intergenic
1058846381 9:108963766-108963788 CAGGATAAAGACACAGTGCAGGG + Intronic
1059430573 9:114247752-114247774 CCCCATGTGGTCACAGTGAAAGG + Intronic
1185914512 X:4021344-4021366 CACGATAAGAACACAGAGAGAGG - Intergenic
1186064297 X:5744929-5744951 TCCGATAAGGACGCTTTGAATGG + Intergenic
1186146776 X:6632377-6632399 CCACATGAGGACACAGGGAAAGG - Intergenic
1190993886 X:55585207-55585229 CCATGTAAGGACACAGTGAAAGG + Intergenic
1195743112 X:108086582-108086604 CCCCAAAAGGAAACAGAGAAAGG + Intronic