ID: 1118329534

View in Genome Browser
Species Human (GRCh38)
Location 14:64804710-64804732
Sequence TGGGAGAAGCATGAAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 457}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118329524_1118329534 11 Left 1118329524 14:64804676-64804698 CCAGAGCCCAAAGTCAGGAGCTC 0: 1
1: 1
2: 3
3: 31
4: 274
Right 1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG 0: 1
1: 0
2: 5
3: 39
4: 457
1118329526_1118329534 4 Left 1118329526 14:64804683-64804705 CCAAAGTCAGGAGCTCTGCATGG 0: 1
1: 0
2: 2
3: 17
4: 166
Right 1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG 0: 1
1: 0
2: 5
3: 39
4: 457
1118329521_1118329534 25 Left 1118329521 14:64804662-64804684 CCAGCTACAGATGCCCAGAGCCC 0: 1
1: 0
2: 0
3: 17
4: 206
Right 1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG 0: 1
1: 0
2: 5
3: 39
4: 457
1118329525_1118329534 5 Left 1118329525 14:64804682-64804704 CCCAAAGTCAGGAGCTCTGCATG 0: 1
1: 0
2: 0
3: 17
4: 265
Right 1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG 0: 1
1: 0
2: 5
3: 39
4: 457
1118329523_1118329534 12 Left 1118329523 14:64804675-64804697 CCCAGAGCCCAAAGTCAGGAGCT 0: 1
1: 0
2: 1
3: 29
4: 221
Right 1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG 0: 1
1: 0
2: 5
3: 39
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118329534 Original CRISPR TGGGAGAAGCATGAAGGGGT GGG Intronic
900094009 1:933046-933068 TGGGAGAAGCAGTCAGGGCTGGG - Intronic
900154534 1:1198683-1198705 TGGGAGATGAGTGAGGGGGTGGG - Intergenic
901461378 1:9393872-9393894 TGGGAGAAGAAAGCAAGGGTGGG - Intergenic
902671752 1:17979576-17979598 GGGGAGAAGATGGAAGGGGTGGG - Intergenic
904386918 1:30148920-30148942 TGAGAGATGCAGGCAGGGGTGGG - Intergenic
904709765 1:32421118-32421140 TGGAAGAAGCAGAAAGGGATGGG + Intergenic
904754400 1:32760247-32760269 GGGGAGAGGAATGAAGGGGGAGG - Intronic
904796242 1:33058418-33058440 TGTGAGCAGCATGAGAGGGTGGG + Intronic
904890509 1:33776163-33776185 CTAGAGAAGAATGAAGGGGTGGG + Intronic
905627052 1:39496014-39496036 TGGGAGAAGCAGGACTGAGTGGG + Intronic
905669883 1:39784757-39784779 TGGGAGAAGCAGGACTGAGTGGG - Intronic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
906206058 1:43987018-43987040 TGGGAGAAGCATGAGGCACTGGG + Intronic
906515963 1:46438926-46438948 GGGAAGAAGAATGAAGGGCTGGG + Intergenic
906686868 1:47768431-47768453 TGAGAGAACCATGAAAGGGGAGG - Intronic
907744164 1:57196038-57196060 GGGGAGTAGGAGGAAGGGGTGGG + Intronic
908802869 1:67898123-67898145 TAGGAAAGGCATGAAGGGGCAGG - Intergenic
909730922 1:78888362-78888384 TGAGACAAGCATGAAAGGCTTGG + Intergenic
910515765 1:88058307-88058329 TGGCAGGAGCATGAAGGCGGAGG + Intergenic
911091562 1:94021484-94021506 TTTGAGAAGCAGGAAGGGTTTGG + Intronic
912466663 1:109879329-109879351 TGGGGGAATCATAAAGGGGAGGG + Intergenic
912582926 1:110736388-110736410 TGTGAGGAGCAGGAAGTGGTTGG - Intergenic
912614449 1:111084121-111084143 AGAGAGAAGCATGAAGGGGGAGG - Intergenic
912647171 1:111404308-111404330 TGGCAGAAGCATGATGTTGTAGG - Intergenic
912694548 1:111831413-111831435 TGGGAGCAGGAGGAAGAGGTTGG - Intronic
913089655 1:115467936-115467958 TGGGGGTAGGATGAGGGGGTGGG + Intergenic
913669128 1:121078906-121078928 TGGAAGCAGCAGGCAGGGGTGGG - Intergenic
914020873 1:143866303-143866325 TGGAAGCAGCAGGCAGGGGTGGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
917583911 1:176405704-176405726 TGGAAGAGGCAGGAAAGGGTGGG - Intergenic
917861933 1:179154352-179154374 TGTGAGAAGAATGAAGAGCTGGG - Intronic
920300624 1:204986484-204986506 GGGGAGAACCGTGAAGGTGTTGG - Intronic
920397887 1:205659857-205659879 TGGGAGAAGGGTAACGGGGTAGG + Intronic
920739606 1:208568031-208568053 TGGGATAAGCATGAAGGTGGGGG + Intergenic
920794328 1:209124082-209124104 TGAGAGGAGCAAGAAGGTGTTGG - Intergenic
921696238 1:218214321-218214343 TGGGGGAAGCCAGAAGGGGATGG - Intergenic
923109932 1:230882525-230882547 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
923219818 1:231882934-231882956 TAGGAGAAGAAGGAATGGGTGGG + Intronic
923920244 1:238555939-238555961 TGCCAGAAGAATGAAGAGGTGGG - Intergenic
924440407 1:244081141-244081163 TGGTAGAAGCATGAAGTCTTGGG + Intergenic
924586852 1:245367689-245367711 TGGCAGAGCCATGAAGAGGTAGG + Intronic
1062799135 10:366914-366936 TGGGCAAAGCATGAAAGTGTTGG - Intronic
1063375765 10:5553464-5553486 GGGGCGAGGTATGAAGGGGTAGG + Intergenic
1063656355 10:7994051-7994073 TGGGAGAGAGAAGAAGGGGTAGG - Intronic
1064488523 10:15823772-15823794 TGGGAGAAGCATGAGGGGAGTGG - Intronic
1065099127 10:22316482-22316504 GAGGAGAAGCGTGAAGGCGTTGG - Exonic
1067571709 10:47376621-47376643 GGGGAGAAGGAGGATGGGGTGGG - Intronic
1068044674 10:51871367-51871389 TGGGGGAAGCAAGAAGACGTGGG - Intronic
1068444770 10:57107080-57107102 TGTTAGAAGCATGAAGAAGTGGG + Intergenic
1068717561 10:60205074-60205096 TGGGACAAGTCTGAAAGGGTAGG + Intronic
1070158910 10:73853665-73853687 TGGGAGCAGAACTAAGGGGTGGG + Intronic
1070819945 10:79348667-79348689 AGGGAGAGGCATGAGGGTGTGGG - Intronic
1071718473 10:88120077-88120099 TGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1071930019 10:90458546-90458568 GGTGAGAAGCATGGAGGGGTTGG + Intergenic
1072261030 10:93673322-93673344 TGGGAGAAGAGTGAAAGGATGGG - Intronic
1072574545 10:96687993-96688015 ATGGGGAGGCATGAAGGGGTGGG + Intronic
1072792571 10:98328980-98329002 TGGCAGAAGCATGAAGGAGCAGG + Intergenic
1073101414 10:101008616-101008638 CTGGAGCAGCATCAAGGGGTTGG + Intronic
1073190402 10:101646747-101646769 AGGGAGAAGGATGAAAGGTTTGG + Intronic
1073422327 10:103434383-103434405 GGGGAGCGGCAGGAAGGGGTGGG + Intronic
1074317816 10:112375301-112375323 TGGAAGAAAGATGAAGGGCTGGG - Intronic
1074825925 10:117215943-117215965 TGGGAGAAGCATGAGGGCTGGGG + Intergenic
1074900631 10:117813500-117813522 GGGGTGAAGCATGAAAGTGTTGG - Intergenic
1075445214 10:122508300-122508322 TGGGAGAAGCAGGAAGGTGTGGG + Intronic
1075561621 10:123472664-123472686 AGGGAGAAGCAAGGAGGGGATGG + Intergenic
1075688643 10:124380569-124380591 GGGGAGAAGCATGGAGGAGATGG - Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1077071598 11:676408-676430 TGGGTGGAGCAGGAAGGGATGGG - Intronic
1077472790 11:2772088-2772110 TGGGAGCAGCATGGAGGGGTGGG + Intronic
1077557162 11:3231284-3231306 GGGGAGAGGCATGAAGAGATGGG + Intronic
1077609523 11:3635883-3635905 TGAGAGGACCAGGAAGGGGTGGG - Intergenic
1077726781 11:4682816-4682838 TGGGAGAAGACAAAAGGGGTGGG - Intronic
1078725792 11:13929787-13929809 TGGGAAAAGCATTCAGGGGAAGG + Intergenic
1079437993 11:20477255-20477277 TGGTAGACACATCAAGGGGTGGG + Intronic
1080084687 11:28265403-28265425 TGAGAAAAGCATGAAAGAGTTGG + Intronic
1080931923 11:36819874-36819896 TGGGAGAATGATGAAGAGATAGG + Intergenic
1081599557 11:44483900-44483922 AGGGATGAGGATGAAGGGGTGGG - Intergenic
1081660011 11:44882301-44882323 TGGGAAAAGGAAGAACGGGTAGG - Intronic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1083012510 11:59416754-59416776 TGGGAGAATCATCAAGATGTGGG - Intergenic
1083969419 11:66064736-66064758 TGGGAGAAGGCTGAGGTGGTAGG + Intronic
1085557747 11:77440851-77440873 TGGGAGGAGCAGGTAGAGGTGGG - Intronic
1085557752 11:77440870-77440892 TGGGAGGAGCAGGTAGAGGTGGG - Intronic
1085886769 11:80531659-80531681 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1086346451 11:85902163-85902185 TGGCAGAAGCAGGTGGGGGTGGG + Intronic
1086376007 11:86201357-86201379 TGGGAGAGGCCTGGAGGGGCAGG + Intergenic
1088359414 11:108975246-108975268 TGGCAGAGGCATGGAGAGGTAGG - Intergenic
1088575548 11:111267712-111267734 TGGGAGAGCATTGAAGGGGTGGG - Intronic
1088970059 11:114766022-114766044 AGGGAGAAACATGAAGTGTTTGG - Intergenic
1089559443 11:119336443-119336465 TGCGTGGAGCATGGAGGGGTGGG - Exonic
1089598491 11:119598115-119598137 TGGGAGAAGGATGGAGATGTGGG + Intergenic
1089929928 11:122299693-122299715 TGGCAGGAGCAAGAAGGGGGAGG + Intergenic
1090604565 11:128407779-128407801 TGGGAGAAGGAAGAATGGCTGGG - Intergenic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091274519 11:134341659-134341681 TGTGAGAAGTAGGAAGGAGTAGG + Intronic
1091638890 12:2219277-2219299 AGGCAGAAGCCTGAAGGGATAGG - Intronic
1092195799 12:6548921-6548943 GGGGAGAAGCATGAACCAGTAGG + Intronic
1092396172 12:8128739-8128761 TGGGAGAAACATGAGAGCGTTGG + Intronic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1092699306 12:11209422-11209444 TGGGAAAAGAATAAAAGGGTAGG + Intergenic
1093148573 12:15595767-15595789 TGGGAGAATCATGAAAGTCTGGG + Intronic
1093616671 12:21233658-21233680 TGGGAGAAGAAAGGAGGAGTTGG + Intronic
1093985638 12:25529196-25529218 TGGGAGATGCGTGAAGGGGCTGG - Intronic
1094033456 12:26040472-26040494 TGGAAGAGGCAGGAAAGGGTAGG + Intronic
1095488205 12:42706212-42706234 TGGACGAAGCCTGCAGGGGTGGG + Intergenic
1096113512 12:49042160-49042182 TGGGAGAAGGATGAGGAGTTGGG - Exonic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1097241274 12:57576973-57576995 TGGGAAAAATATGATGGGGTAGG + Intronic
1097973510 12:65660550-65660572 TGGGAGAATTAGGAAGGTGTAGG - Intergenic
1098811036 12:75092737-75092759 TGGCAGAAATATGAAGAGGTTGG - Intronic
1101026323 12:100609915-100609937 TGGAAGATGGAGGAAGGGGTGGG + Intronic
1101931137 12:109015227-109015249 AGGCAGCAGCATGAATGGGTAGG + Intronic
1102239771 12:111317561-111317583 TGGGAGAGGAAGGCAGGGGTGGG - Intronic
1103074926 12:117974427-117974449 TGGGTGAAGCTGGAAGGGGCAGG - Intergenic
1103902493 12:124310607-124310629 TGTGAGGAGCAGGATGGGGTGGG + Intronic
1104033035 12:125078967-125078989 TGGGAAAGGGATGATGGGGTGGG + Intronic
1104672855 12:130692330-130692352 TGGGAGGAGAGGGAAGGGGTAGG - Intronic
1105580342 13:21689890-21689912 TGGAAGAAGCAGGAAGAGCTTGG - Intronic
1107585840 13:41847528-41847550 AGGGAGAAGGCTGAAGAGGTAGG + Intronic
1108459096 13:50647314-50647336 AGAGTGAAGCCTGAAGGGGTTGG + Intronic
1108638981 13:52364395-52364417 GGGGAGAAGCATGAGCAGGTTGG + Intergenic
1108650961 13:52479162-52479184 GGGGAGAAGCATGAACAGGTTGG - Intergenic
1109392923 13:61716758-61716780 TGGGAGAGGGAAGAAGGTGTGGG - Intergenic
1111982775 13:95034401-95034423 TGGCAGAAGCGGGTAGGGGTTGG - Intronic
1112322743 13:98422125-98422147 TGGGAGCAGCCTGAAGGAGGTGG + Intronic
1112662920 13:101534204-101534226 GGGGAGAACCATTAATGGGTGGG + Intronic
1112727118 13:102317732-102317754 TGGTAGAAGCCAGAAGGGGTGGG - Intronic
1114269911 14:21094273-21094295 GGGGAGGGGCATGAAGGGGGAGG + Intronic
1114690590 14:24576286-24576308 TGAGAGAGGAAGGAAGGGGTGGG + Intergenic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1118381204 14:65219008-65219030 TGGGAGAGAAATGAAGGGTTAGG - Intergenic
1119875926 14:78059295-78059317 TGGAAGAAGTATGAAGGAGGCGG + Intergenic
1121472433 14:94165873-94165895 ATGGAGGAGCCTGAAGGGGTCGG - Intronic
1122105986 14:99455286-99455308 TGCGATATGCATGATGGGGTGGG - Intronic
1122515339 14:102304750-102304772 TGGGGGAAGCTTGAGGGGTTGGG - Intronic
1122587443 14:102819118-102819140 AGGGAGAAGGATGCAGGGCTGGG - Intronic
1122781696 14:104146480-104146502 TGGGAAGAGCATGGAGGGCTTGG + Intronic
1202918725 14_KI270723v1_random:10820-10842 TGGCAGAAGGATGAGGGAGTGGG + Intergenic
1202925899 14_KI270724v1_random:23750-23772 TGGCAGAAGGATGAGGGAGTGGG - Intergenic
1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG + Intronic
1124363105 15:29053356-29053378 TGGGATAAGCCTGAAGGGGAAGG + Intronic
1124412873 15:29451339-29451361 TGGGAGAGGCGAGAAGGGGTGGG - Intronic
1124991124 15:34674739-34674761 TGGGGGAAGCATGGAGGGAGAGG + Intergenic
1125385629 15:39133510-39133532 AGTGAGAAGCAAGAGGGGGTTGG + Intergenic
1125584248 15:40809061-40809083 TGGGAGCAGCCTGCAGGGGCGGG + Intronic
1127251638 15:57244702-57244724 TGGGAGAAGGATGAAGCAGGTGG - Intronic
1127646471 15:60964175-60964197 TGGGAAAACCATTCAGGGGTAGG - Intronic
1127869976 15:63063934-63063956 AGGGCAATGCATGAAGGGGTTGG - Intronic
1127969584 15:63947846-63947868 TGGGAGAAGGAAGAAGAGCTGGG - Intronic
1128355391 15:66923000-66923022 TGGGAGAAACAGGAAAGGGGTGG - Intergenic
1128522845 15:68386896-68386918 TGAGAGAAGCAGGGAGAGGTGGG + Intronic
1128987301 15:72230846-72230868 TGGGACCAGAATGAGGGGGTAGG + Intronic
1129242603 15:74260437-74260459 TGAGGGCAGCATGAAGGGGAAGG - Intronic
1129302723 15:74635231-74635253 AGGGAGAAGCATAAGGGGATGGG + Intronic
1129615888 15:77098465-77098487 AGGGAGAAGTCTGATGGGGTTGG + Intergenic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1130176026 15:81571878-81571900 CGGGAGAAACATGGAAGGGTTGG + Intergenic
1130391812 15:83463066-83463088 TCAGGGAAGCATGAAGGGGAAGG + Intronic
1130688813 15:86062448-86062470 TGGGGGAAGCATTAAGTGGAAGG + Intergenic
1130924564 15:88375378-88375400 TGGGAGAATGGTGAAGGGCTAGG - Intergenic
1131011144 15:89019507-89019529 TGGGTGAAGTAGGAAGGGGAAGG - Intergenic
1131053631 15:89363150-89363172 GGGGATAAGAAGGAAGGGGTAGG - Intergenic
1131459570 15:92608824-92608846 TGGGAGAAGAGTGGAGGGCTGGG + Intergenic
1133570482 16:7035270-7035292 TGGGTGAGGAATGAAGGGGAGGG - Intronic
1134136793 16:11681826-11681848 TGGGAGGAAGAGGAAGGGGTGGG - Intronic
1134599591 16:15523059-15523081 TGGGGGAAGCCAGAAGGGGATGG + Intronic
1134603089 16:15548939-15548961 TGGGCTAAGCAGGAATGGGTGGG + Intronic
1135153909 16:20035773-20035795 GGGGAGAAGTATGAAGAGTTGGG + Intronic
1135556951 16:23445180-23445202 GGGGTGAAAAATGAAGGGGTAGG + Intronic
1136064203 16:27747748-27747770 TGGGAGAGGCTGGGAGGGGTGGG + Intronic
1136609903 16:31359896-31359918 TGGGAGAAGCACACAGGGCTGGG - Intronic
1136997754 16:35202404-35202426 TGGGAGAAGCAGGCAGGGTGGGG + Intergenic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137684071 16:50373788-50373810 GGAGAGAAGCAGGACGGGGTGGG + Intergenic
1137823552 16:51468288-51468310 TAGGAGAAGCAAGAAGAGTTTGG - Intergenic
1138440941 16:57034713-57034735 TGGGAGAAGGATGAAGGGGGTGG - Intronic
1140454818 16:75098867-75098889 TGCTAGAAGTATGGAGGGGTGGG - Intronic
1141163680 16:81646110-81646132 TGGGTGAAGGATGGATGGGTGGG + Intronic
1141173420 16:81704670-81704692 AGGGAGGAGGATGAAGGGGTAGG - Intronic
1141514577 16:84535148-84535170 TGGGAGAAGGAGGAGGGAGTAGG - Intronic
1142128615 16:88422241-88422263 TGGTAGAAGCATGGATGGATGGG + Intergenic
1143103078 17:4514682-4514704 AGGGAGACCCAGGAAGGGGTAGG - Intronic
1145193561 17:20867900-20867922 TGGTAGAAACGTGATGGGGTAGG - Intronic
1146172945 17:30646938-30646960 TGGGAGAAGCAGGCAAGTGTGGG + Intergenic
1146346401 17:32062964-32062986 TGGGAGAAGCAGGCAAGTGTGGG + Intergenic
1147325674 17:39668316-39668338 AGGGAGATGGATGAATGGGTGGG + Exonic
1147722272 17:42546669-42546691 TGGGAGACACAACAAGGGGTGGG + Intergenic
1147723457 17:42552839-42552861 TGGGAGACACAACAAGGGGTGGG + Exonic
1148020186 17:44548216-44548238 TGGGAGAAGCAAGAGGGAGAAGG + Intergenic
1148439312 17:47703400-47703422 GGTGAGAAGCGTGAAGGGGGAGG - Intronic
1148795322 17:50194215-50194237 GGGGAGAAGCATGATGGAGGTGG + Intronic
1149600684 17:57891246-57891268 GGGGAGAAGCAGGTTGGGGTCGG - Intronic
1150196794 17:63307085-63307107 TGTGAGATGCCTGCAGGGGTAGG + Intronic
1152199888 17:78939265-78939287 TGGGAGAAGAATGAATGAGACGG - Intergenic
1152318232 17:79593237-79593259 TGGGAGAAGGAGGAAGGATTGGG - Intergenic
1152380266 17:79938725-79938747 TGGGCTCAGCATTAAGGGGTGGG - Exonic
1152386769 17:79979449-79979471 TGGGAGAGGCCTGAAGCGGGAGG + Intronic
1153396507 18:4627707-4627729 AGGGTGAAGGATGAAGAGGTGGG + Intergenic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155412273 18:25559641-25559663 GGGGAGAAGCGTGAATGGGAGGG + Intergenic
1155757803 18:29523580-29523602 TTGGAGAAGAATGTAGTGGTGGG - Intergenic
1155921930 18:31611972-31611994 TGGGAGAAGAATGAATGGGATGG - Intergenic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1157216856 18:45791429-45791451 GGTGAGAAGCAAGATGGGGTTGG - Intergenic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1158646193 18:59249830-59249852 TGGGAGAGGTAGGAAGGGGTGGG + Intergenic
1159841036 18:73399245-73399267 AGGGAAAAGGATGAAGGGGGAGG + Intergenic
1160042325 18:75357133-75357155 TGGCAGAAGGATGAAGGGGAAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161292088 19:3499981-3500003 TGGGAGCAGCGTGAAGAGTTAGG + Intronic
1161567443 19:5011582-5011604 TGGGAGAGGCAGGCAGGGCTGGG + Intronic
1162085847 19:8248689-8248711 GGGGAGATGGATGAATGGGTGGG + Intronic
1162331523 19:10032700-10032722 TGGGAGGGGCATAAGGGGGTGGG + Intergenic
1162934394 19:13974190-13974212 TGAGTGAAGCAGGAAGGGGGTGG + Intronic
1162989477 19:14293157-14293179 TGGGAGAAGCAGGCAAGTGTGGG - Intergenic
1163099511 19:15085976-15085998 TGGTGGAAGGATGAAGGGGAAGG + Intergenic
1163207782 19:15816007-15816029 TTGGAGAAGAATGAAGGTGACGG - Intergenic
1164459865 19:28437507-28437529 TGGGAGAAGTAGGAAGGAGGAGG + Intergenic
1164514611 19:28923074-28923096 CGGGAGAAGAATGCAGGGGCTGG + Intergenic
1166101912 19:40576297-40576319 AGCCAGAAGCATGCAGGGGTGGG - Exonic
1166170750 19:41026159-41026181 TGGGAGAGGAACGCAGGGGTGGG + Intergenic
1166241512 19:41497916-41497938 CGGGGGAAGCTTGAAGAGGTAGG - Intergenic
1166302153 19:41917451-41917473 TGGGTGAGGGATGAAGGGGCTGG - Intronic
1166365777 19:42277871-42277893 TGGGAGAAGAATGAAAGGGCAGG - Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1166848759 19:45747203-45747225 TGAGGGAAGGATGAAGAGGTGGG - Intronic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1167509225 19:49887591-49887613 GGCGAGAGGCCTGAAGGGGTGGG + Intronic
1167555621 19:50193349-50193371 TGGGGGTGGCAAGAAGGGGTCGG + Intronic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168464934 19:56594819-56594841 TGGAAGAAGGATGGAGGGGAAGG - Intergenic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
925260517 2:2524616-2524638 TGGGAGCAGCATCAATGGGTAGG + Intergenic
926111247 2:10185533-10185555 TGGGAGAGGAGTGAATGGGTGGG - Intronic
927056503 2:19370289-19370311 TGGGAGCAGCAACCAGGGGTTGG + Intergenic
927333599 2:21894594-21894616 TGGAGGAGGCATGCAGGGGTTGG - Intergenic
927684666 2:25161977-25161999 AGGCAGAAGCATGAAGGGGATGG - Intronic
928158601 2:28899940-28899962 TGGTAGAAGCAAGCAGGGGCAGG - Intronic
929596760 2:43180836-43180858 TGGGAGAACCAGGAAGGGAGAGG - Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931786378 2:65622735-65622757 TGTGGGAGGCATGAAGGGGAAGG + Intergenic
931867230 2:66426110-66426132 TGGGAGAAGCGTGAGGGGATTGG - Intergenic
932143209 2:69297466-69297488 TGGGATCAGCAGGGAGGGGTTGG - Intergenic
932433274 2:71687901-71687923 AGGGAGAGGAAGGAAGGGGTGGG + Intergenic
933147241 2:78869138-78869160 TGGGATAAGCATGTTGGAGTTGG + Intergenic
933291929 2:80447674-80447696 TGGGAGAAGGATGAAGGGAAGGG - Intronic
937074527 2:119091268-119091290 TTGGATATGGATGAAGGGGTAGG + Intergenic
937403472 2:121606301-121606323 AGCGAGAAGCATGAACGGCTTGG + Intronic
939222444 2:139319605-139319627 TGGGAGAAGAATGAAGATCTGGG + Intergenic
940665910 2:156609500-156609522 TAGGGGAAGCATGAAGGTTTAGG + Intronic
940913467 2:159229310-159229332 AGGGAGAAGCATGAATCAGTGGG - Intronic
941982958 2:171479910-171479932 TGGGAGAAGAATGAATGAATGGG - Intronic
943768824 2:191693102-191693124 TTTGAGATGCATGAAGGGCTAGG - Intronic
944275092 2:197827301-197827323 TGTGAGAAGTAGGAAGTGGTAGG - Intronic
944339547 2:198580153-198580175 TGGGAGAAGCCAGAAGGGAATGG + Intergenic
945653627 2:212596170-212596192 TGGGAGAAGCATAAAGGAATAGG + Intergenic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
946410173 2:219511717-219511739 TGGGGGAAGCAGGGAGGGGTGGG + Intergenic
946427209 2:219605753-219605775 TGGGGCAAGCATGGAGGGGAAGG + Intronic
947906350 2:233766200-233766222 TGGGGGAAGCCAGAAGGGGATGG + Intronic
948003549 2:234589101-234589123 TGGGAGCAGGAGGAAGGGGCAGG + Intergenic
948097358 2:235347050-235347072 TGAGAGAAGGATGCAGGGATGGG - Intergenic
1169462543 20:5808289-5808311 GGGGAGAAGCATGAAGACCTAGG - Intronic
1169503118 20:6180558-6180580 TGGGAAAAGCAGGATGGAGTAGG - Intergenic
1169735188 20:8830316-8830338 TGCAAGAAGCATCAAGGGCTTGG + Intronic
1170594030 20:17792239-17792261 CGGGTGAAGCATGAAGGGCATGG + Intergenic
1170842133 20:19932592-19932614 TGGATCAAGCATGAAGGGCTTGG + Intronic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171782705 20:29435516-29435538 TGGCAGAAGGATGAGGGAGTGGG + Intergenic
1172149538 20:32780292-32780314 TGGGAGAAGCCAGAATGGGTGGG - Intronic
1172177656 20:32982366-32982388 TGGGAGGGGCATGTGGGGGTGGG + Intergenic
1172287497 20:33751290-33751312 TGAGAGAATCATGAATGTGTGGG - Intronic
1172479790 20:35264244-35264266 GGAGAGAAGCATGAAGGGACGGG - Intronic
1173025644 20:39305257-39305279 TGAGAGAAGCAGGATGGGCTGGG + Intergenic
1173145542 20:40521095-40521117 TAGGAGGAGCAGGGAGGGGTGGG - Intergenic
1173191299 20:40878053-40878075 TGGGTGATCCATGATGGGGTAGG + Intergenic
1174287133 20:49481744-49481766 TGGGAAAAGTCTGAGGGGGTTGG + Intronic
1174934949 20:54857250-54857272 TGGGAAAGGCAGGATGGGGTAGG - Intergenic
1175100582 20:56576101-56576123 TGGGAGAGGCAGGGAGGGGCTGG - Intergenic
1175375106 20:58518776-58518798 AGGGACAAGGATGAAGAGGTAGG - Intergenic
1175376855 20:58533681-58533703 TGGGAGAAGTATGTATGGCTTGG + Intergenic
1175383294 20:58578175-58578197 TGGGGGAGGCAGGATGGGGTGGG - Intergenic
1175515935 20:59569796-59569818 TGTGAGAAGAAGGCAGGGGTTGG - Intergenic
1175816633 20:61886482-61886504 TGGCAGAAGCAGGAAGGGTAGGG + Intronic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1178114036 21:29398701-29398723 TGGGAGAAATATGAAGTGGCAGG - Intronic
1178464540 21:32835007-32835029 TGTGTGGAGCATGGAGGGGTGGG + Intergenic
1179715060 21:43282193-43282215 GGGCAGAGGCATGACGGGGTAGG - Intergenic
1179727457 21:43348403-43348425 TGGCAGAGGCAGGAAGGGGCTGG - Intergenic
1181638829 22:24186492-24186514 TGGGAGAGGCATGAAGGCCCAGG - Intronic
1182351673 22:29703272-29703294 AGGGGGAAGGATGAAGGCGTGGG - Intergenic
1182446221 22:30391155-30391177 TGGCAGAAGGATGAAGGGCAGGG + Intronic
1182490393 22:30667905-30667927 TGGGAGACGCATAAGGGGGCGGG - Intronic
1182710984 22:32323253-32323275 TGTGAAAAGCATGCAGGGGAGGG - Intergenic
1183201502 22:36388079-36388101 TGGGTGTAGCAGGAAGGGGGCGG - Intergenic
1183237112 22:36627191-36627213 TGGGGGAAGGAGGAAGGAGTGGG + Intronic
1183266365 22:36828652-36828674 TGGGAGCAGGAGGAAAGGGTGGG + Intergenic
1183332253 22:37228014-37228036 TGGGAGAATCCTGGAGGGATGGG - Intronic
1183362291 22:37388996-37389018 TGGGAGAAGCATGCGGGGCTTGG + Intronic
1183828925 22:40407870-40407892 TGGGAGAGGGAGGAGGGGGTGGG + Intronic
1184340907 22:43885370-43885392 TGGGAAGAGGCTGAAGGGGTGGG - Intronic
1184354192 22:43967617-43967639 TGGGAGAAGCCTGCAGGTGAAGG - Intronic
1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG + Intergenic
1185093917 22:48795517-48795539 TGGTAGAAGGAGGAAGGGGCAGG - Intronic
1185126610 22:49014714-49014736 TGGGAGGAGCATGGAGGGGTGGG - Intergenic
950152817 3:10701307-10701329 TGGGTGAACCATGAAGGGTGAGG - Intronic
951341286 3:21490476-21490498 TGAGACAGGCATAAAGGGGTAGG - Intronic
953261079 3:41339498-41339520 TGGGAGAAGCAGGAGAGGGGAGG - Intronic
953571742 3:44076644-44076666 TGGTGGAAGCAGAAAGGGGTGGG + Intergenic
953770584 3:45776168-45776190 CGGGTGAGGCAGGAAGGGGTTGG + Intronic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954595219 3:51818779-51818801 TGGGAGAGGTCTGAAGGGATGGG + Intronic
954677268 3:52322832-52322854 GGGGAGAAGGATGAAAGGATGGG - Intronic
955869606 3:63423448-63423470 TGGGGCAAGTATTAAGGGGTTGG + Intronic
955950290 3:64236988-64237010 TGTGGGACTCATGAAGGGGTTGG + Intronic
956018475 3:64909247-64909269 TAGGAAAAGCAAGAAGGAGTGGG + Intergenic
957082773 3:75650818-75650840 TGGCAGAAGGATGAAGGAGTGGG - Intergenic
957167359 3:76692071-76692093 TGGGAGAAGAATGGAGATGTAGG + Intronic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
959138114 3:102450522-102450544 AGGGAGGAGCATGCAGAGGTAGG + Intronic
959859310 3:111198812-111198834 TGAGAGAAGTTTGCAGGGGTGGG - Intronic
960854880 3:122092659-122092681 AAGGAGCAGCAGGAAGGGGTGGG - Intronic
961105964 3:124241859-124241881 TGCTAAAAGCACGAAGGGGTAGG + Intronic
961222512 3:125212084-125212106 TGGTAGAAGGAGGAAGGGGGAGG + Intronic
961436807 3:126924784-126924806 TGGGTGAAGCCAGAATGGGTGGG + Intronic
961683806 3:128616441-128616463 TGGGGGCACCATGAAGGGGTTGG + Intergenic
963694877 3:148553883-148553905 TGAGATAAGAAAGAAGGGGTTGG - Intergenic
964564326 3:158033134-158033156 GGGGAGGAGGATGAAGGGGAGGG + Intergenic
964620393 3:158715387-158715409 TGGGAGTGGGATGTAGGGGTTGG + Intronic
964644447 3:158943705-158943727 TGGGAGCAGCTGGAAGGAGTGGG + Intergenic
965932371 3:174060618-174060640 TGGGGGAATCTTGAAGGTGTAGG - Intronic
966770716 3:183501185-183501207 CGGGATAAGGGTGAAGGGGTGGG + Intronic
968309697 3:197673315-197673337 TGGGAGAGGCATTAAGGTGATGG - Intronic
968991691 4:3917585-3917607 TGAGAGGAGAATGAAGGGGAGGG + Intergenic
969291497 4:6242940-6242962 TGGGAGGGGCATGGAGGGGAAGG - Intergenic
969657157 4:8504984-8505006 TGGGGGCAGCATGCAGGGGAGGG - Intergenic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970023349 4:11593653-11593675 TGGGAGAAACATGAGGGACTTGG + Intergenic
971017763 4:22506143-22506165 GGGGAGAAGCAGGAAGGTGCTGG + Intronic
971820250 4:31544064-31544086 TGGGAGAAAGATGTAGGGGGTGG - Intergenic
972561319 4:40231533-40231555 TGTGAGATCCATGAAGAGGTGGG - Intronic
973993659 4:56435891-56435913 TGGGGGAAGCATGCAGGGAAGGG - Intronic
974543930 4:63275665-63275687 TGGCAGCAGCATGACGGGGGTGG - Intergenic
976479609 4:85524911-85524933 TGGGAGAGGGATGAAGGGAGGGG + Intronic
978026620 4:103883722-103883744 TGGGAGAAGCATGTATGCCTTGG + Intergenic
980322015 4:131291221-131291243 TGGGAGAAGCAAGGAGGTGTTGG + Intergenic
981055902 4:140361045-140361067 TGGGAGAAGCAGGCTGGGATGGG + Intronic
981172978 4:141646208-141646230 TGGGAGAACCATGTGGGGTTTGG - Intronic
981249703 4:142585068-142585090 TGGGGGAGGAATGAAGGGATGGG + Intronic
982637339 4:157913655-157913677 TGGAGCAAGCATGAAGGGGAAGG - Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
984482704 4:180326519-180326541 GGGGAGAACCGTGAAGGGGTTGG - Intergenic
984623719 4:181981618-181981640 AGGTAGAAGCTGGAAGGGGTTGG + Intergenic
984807711 4:183766765-183766787 TGAGAGAGGAATGGAGGGGTTGG - Intergenic
985038474 4:185864968-185864990 TGGGGGAAGGATGAACGGGAGGG + Intronic
985176003 4:187201861-187201883 TTGGAGAAGCCTGAGTGGGTAGG - Intergenic
985188725 4:187347097-187347119 TGGGGGAAGGAAGTAGGGGTGGG - Intergenic
985352890 4:189085183-189085205 TGGGAGAAGCTAGAAGGGAGAGG - Intergenic
985552100 5:538954-538976 TGGGAGACGCATGTGGGGCTGGG - Intergenic
986103153 5:4632268-4632290 TGACAGAAGCCTGCAGGGGTAGG + Intergenic
986260399 5:6140550-6140572 GGGCAAAAACATGAAGGGGTCGG + Intergenic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
989193034 5:38689810-38689832 TGGCAGAAGGGTGAAGGGGAAGG - Intergenic
992035462 5:72770342-72770364 TAGGGGAAGCATGAAGTGCTAGG + Intergenic
992779595 5:80116040-80116062 TGAGAGAACCATGATGGGGAAGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
995549367 5:113265713-113265735 TGAGGGAAGCATGATGGAGTTGG - Intronic
996822515 5:127646302-127646324 TGGGTGAGCCATGAAGGGGGAGG + Intergenic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998316157 5:141184559-141184581 TGGGAGCGGCAGGAAGGGCTGGG - Exonic
998944303 5:147321042-147321064 TGGGTCAAGCATGATGGAGTAGG + Intronic
999448824 5:151663512-151663534 TGGGGGAAACACGAAGGGGAGGG + Exonic
999463290 5:151775555-151775577 TGGGAGAAGCCTGCAAGGGCAGG - Intronic
1001082344 5:168676551-168676573 TGGTAAAAGCAGGAAGGGGAGGG + Intronic
1001101641 5:168819180-168819202 TGAGACAGGCAGGAAGGGGTTGG + Intronic
1001482488 5:172097990-172098012 TGGGAAAGGAATGATGGGGTGGG + Intronic
1001835148 5:174825270-174825292 AGGAAGAAGCATGAAGGTTTTGG - Intergenic
1002429584 5:179195224-179195246 TGGGAGGAGCATGCTGGGATTGG - Intronic
1002525135 5:179811367-179811389 GGGGAGGAGCATGCAGGGGGAGG + Intronic
1002666559 5:180829905-180829927 TGGAAGAAGTATGAAGGTGGGGG - Intergenic
1002774911 6:320478-320500 TGGGAGAAGCATGCAGCGCGTGG + Intronic
1002995369 6:2278118-2278140 TTGGAGAAACATGAAGACGTTGG - Intergenic
1003668840 6:8136662-8136684 GGGGAGAAGGATGATGGGGGAGG - Intergenic
1004330870 6:14719514-14719536 TGGGAGAGGAAGGAAGGGGCGGG - Intergenic
1006059530 6:31410222-31410244 AGGGAGGAGCATGAAGGTGGTGG - Intronic
1006282770 6:33068806-33068828 TGGGGGAAGAATGAAGAGATAGG + Intronic
1006675290 6:35758370-35758392 TGAGAGAAGCAGGAAGGGCATGG + Intergenic
1006817897 6:36865528-36865550 TGACAGAGGCATGCAGGGGTAGG - Intronic
1007412940 6:41675295-41675317 GGTGAGAAGCATGGAGGAGTTGG - Intergenic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007834839 6:44666439-44666461 TGGTAGAAGCAGGCAGGAGTGGG - Intergenic
1009565804 6:65310015-65310037 TGGGAGGGACCTGAAGGGGTTGG - Intronic
1009583584 6:65567963-65567985 TGGGAGATACATGGAGAGGTGGG - Intronic
1012731458 6:102887704-102887726 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1013140069 6:107324593-107324615 TGGTTGAAGAAAGAAGGGGTTGG - Intronic
1013465794 6:110415879-110415901 TGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1014251285 6:119117868-119117890 TGAGAGAAACAGGCAGGGGTGGG + Intronic
1014804852 6:125818049-125818071 GGGGAGAAGCGGGAAGGGGGAGG - Intronic
1015341447 6:132105670-132105692 TGGGAAAAACATGAAAGGGAAGG - Intergenic
1016474073 6:144407006-144407028 TCAGACAAGCAGGAAGGGGTAGG - Intronic
1017019783 6:150130866-150130888 TGGGAGGAGCAGGAAGAGGCTGG + Intergenic
1017074967 6:150609543-150609565 TGGGAGAAGCAGGCATGGCTGGG + Intronic
1018740125 6:166722217-166722239 GGGCAGAATCATGCAGGGGTTGG - Intronic
1018854949 6:167668625-167668647 AGGGAGGGGCATGAGGGGGTGGG - Intergenic
1019063263 6:169273673-169273695 TGGGAGCAGGAGCAAGGGGTGGG - Intergenic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1019595328 7:1855776-1855798 TGGGAGAGGCTGGAAGGGTTGGG - Intronic
1020033930 7:4952279-4952301 TGGGACAAGCCTGGAAGGGTGGG + Intronic
1022308620 7:29174176-29174198 TGAGAGGAGCATCAAGGTGTGGG - Intronic
1022656185 7:32321348-32321370 GAGGAGAAGAATCAAGGGGTTGG + Intergenic
1023007245 7:35885091-35885113 TGGGAGGAGCATGATGTGGGAGG - Intronic
1023167674 7:37358848-37358870 TGGGGCAAGGATGACGGGGTAGG + Intronic
1023489752 7:40726432-40726454 GGGGAGCAGAAAGAAGGGGTTGG + Intronic
1023567678 7:41539731-41539753 TGGGTGAAGGATAAAGGGGAGGG - Intergenic
1023821438 7:43982871-43982893 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1023991269 7:45130202-45130224 TGGGGGAAGCAGGGAGGGGTTGG - Intergenic
1025008413 7:55374545-55374567 TGGGAAAAGCAGGCAGGGGTGGG - Intronic
1026346226 7:69476420-69476442 TGGGAGAAGCTCTAAGGGGAAGG + Intergenic
1026775041 7:73226078-73226100 TGGGAGAGGGAAGGAGGGGTGGG + Intergenic
1027015897 7:74779449-74779471 TGGGAGAGGGAAGGAGGGGTGGG + Intronic
1027072132 7:75166488-75166510 TGGGAGAGGGAAGGAGGGGTGGG - Intergenic
1027426792 7:78069171-78069193 TGGGCAAAGGCTGAAGGGGTGGG + Intronic
1028517819 7:91697817-91697839 TGGAAGCACCATGAAGGAGTAGG - Intronic
1029308744 7:99641616-99641638 TGGGAGGAGAATGAAGAGTTTGG - Intergenic
1029338869 7:99926680-99926702 TGAGAGTAACATGAGGGGGTAGG + Intronic
1029749701 7:102536292-102536314 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1029767651 7:102635397-102635419 TGGGAGAGGCAGGCAGGGGATGG - Intronic
1030020641 7:105272145-105272167 TGGAAGAACCATGAAGTGGTGGG - Intronic
1031179328 7:118394502-118394524 CGGGAGAAGCCAGAAGGGGATGG + Intergenic
1031534938 7:122921902-122921924 TGTGAGAAACATGCAGGAGTGGG + Intergenic
1031806550 7:126314891-126314913 TTGGAGAAGCATGAATAGATTGG + Intergenic
1032122549 7:129167749-129167771 TGGGAGAGGCAAGAAGGAATTGG - Intronic
1032700499 7:134374603-134374625 GTGGAGAAGCATGAATGGGAGGG - Intergenic
1033667313 7:143453897-143453919 TGAGAGAAGCATGTTGGAGTGGG - Intergenic
1034337382 7:150332257-150332279 TGGGAGAAGAAGGAAGGGGGTGG + Exonic
1034469441 7:151247688-151247710 TGGGAGGGGTATGGAGGGGTGGG - Intronic
1035224599 7:157426439-157426461 GGGGAGCAGCATGGAGGGGCGGG - Intergenic
1035307973 7:157945462-157945484 CGGGAGAAGAGTGAATGGGTTGG - Intronic
1036039706 8:5062030-5062052 TGACAGAAGCAGGAAAGGGTAGG - Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037590946 8:20311535-20311557 TGGGAGGAGCATAAGGGGGCGGG + Intergenic
1038115228 8:24546429-24546451 TGGGAGATGCAAGAAGAGGCTGG + Intergenic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1040624101 8:49125719-49125741 GAGGAGAAGCAGGAAGGGATCGG - Intergenic
1040682467 8:49829078-49829100 TGTGAGAAGCAGGCAGGGGATGG + Intergenic
1041249643 8:55921724-55921746 TGGGAGAGGCAGGGAGGGGCAGG + Intronic
1041928973 8:63266896-63266918 TGGGAGAAGCCTGAGGGTGGGGG - Intergenic
1042382439 8:68133092-68133114 TGGGAGAAGGCAGAAGGGGAAGG + Intronic
1044751085 8:95416010-95416032 TGGGAGAAGAAGGAAGGGAAGGG - Intergenic
1045263531 8:100598221-100598243 TGGGAGATGCATTAAGGTGCTGG + Intronic
1045696113 8:104810547-104810569 TGGAAGAAGCAGGATAGGGTGGG + Intronic
1045956584 8:107915347-107915369 CGGGAGAAGGAAGAAGGTGTTGG - Intronic
1046076210 8:109315278-109315300 TGGGAGAAACAGGAAGGGAGGGG - Intronic
1046363167 8:113187858-113187880 TTGGAGAAGTATAAAGGGGTAGG - Intronic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1046943759 8:119955869-119955891 TGGAAGAAGAAGGAAGGGGAGGG + Intronic
1047475276 8:125222515-125222537 TGGGGGAAGGGGGAAGGGGTTGG - Intronic
1047718238 8:127615550-127615572 TGGGAGAGGTAGGAAGGCGTGGG - Intergenic
1048220220 8:132534230-132534252 TGGGAGACCCATGGAGGGTTAGG - Intergenic
1049548758 8:143246776-143246798 TGGGTGAAGCCTGAGGGGGCGGG + Intergenic
1049877212 8:145032504-145032526 TGGGAGGGGGAGGAAGGGGTGGG - Intergenic
1050202151 9:3157029-3157051 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1050204523 9:3182620-3182642 TGGGAGAAAGAAGAAGGTGTGGG - Intergenic
1053096551 9:35333539-35333561 AGGGAGAAGGAGGAAGGCGTTGG - Intronic
1053217075 9:36280554-36280576 TAGGAGAAGCATGAAGGAGGAGG - Intronic
1054735403 9:68745207-68745229 GGGGAGAAGCAGGGAGGGGCAGG + Intronic
1054925997 9:70589361-70589383 TGGGAGAAGGAGGGAGGTGTAGG - Intronic
1055140185 9:72868057-72868079 TGGCAGAAGGCTGAAGGGGAAGG - Intergenic
1055199815 9:73646542-73646564 TGGGGGAAGCCAGAAGGGGATGG + Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055442546 9:76350921-76350943 TGGGAGAGGTATGGAGGGCTGGG + Exonic
1057302499 9:93894948-93894970 AGGGAGATGCAGGAAGGGGGCGG - Intergenic
1057506278 9:95636137-95636159 TGGGGGTAACATGGAGGGGTGGG + Intergenic
1058798280 9:108519373-108519395 TGAGAGAACCATCAAGGGGAAGG - Intergenic
1059496833 9:114717138-114717160 TGGGAGAAGCCTGGGTGGGTGGG - Intergenic
1060730385 9:126033439-126033461 GGGGAGATGCAGGAAGGGGCTGG - Intergenic
1061035205 9:128109723-128109745 TGGGAGGAAAATGAAGGGTTCGG - Intergenic
1061324758 9:129856862-129856884 CGGGAGAAGCTGGAAGGGTTTGG + Intronic
1061678573 9:132231609-132231631 TGGGAAAAGCAAGAGAGGGTTGG - Intronic
1062193096 9:135257649-135257671 TGGGAGAAGCAGGAGGGATTTGG + Intergenic
1062578973 9:137221413-137221435 TGGGAGGAGGAGGAAGGGGTGGG + Intronic
1185867880 X:3639327-3639349 TGGTAGATGGATGAAGGGGTGGG + Intronic
1186217118 X:7312157-7312179 TGGGAACAAGATGAAGGGGTTGG - Intronic
1186350251 X:8732409-8732431 TGGGAGGGGCAGGAAGCGGTTGG - Intergenic
1187722432 X:22165325-22165347 TGGGAGAAGCAAGACAGGGAGGG + Intronic
1188156620 X:26749169-26749191 TAGGAGAAGCAAGTAGGGGTGGG - Intergenic
1188520596 X:31033695-31033717 TGGAAGAAGAATGAAGAGGCAGG - Intergenic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1189872994 X:45404230-45404252 TGGGAGGAACTTGAAGGGGAGGG + Intergenic
1190042117 X:47079858-47079880 TGGGAGAAGGATGAAGATGCAGG + Intronic
1190332833 X:49246694-49246716 CGGGGGAAGCAGGAAGGTGTAGG - Intronic
1190989260 X:55528530-55528552 TGGGAGTAGACTGAAGGAGTAGG + Intergenic
1191041625 X:56087356-56087378 TGAGAAAAGCATCAAGGGGATGG - Intergenic
1191675276 X:63786082-63786104 TGGGGGAATCATAAAGAGGTGGG - Intergenic
1192167501 X:68835023-68835045 TATGAAAAGCCTGAAGGGGTTGG - Intronic
1194084157 X:89505630-89505652 TGGAAGAAAAATGTAGGGGTTGG - Intergenic
1194615391 X:96095098-96095120 TGTGAGAAGCAGGGAGAGGTAGG + Intergenic
1197467224 X:126819935-126819957 TGGGACAGGGATGAATGGGTTGG + Intronic
1199704513 X:150412321-150412343 TAGGGGAAGCCTGGAGGGGTGGG - Intronic
1200324102 X:155219671-155219693 TGGGAAATGCATAAAGTGGTGGG + Intronic
1200436800 Y:3161516-3161538 TGGAAGAAAAATGTAGGGGTTGG - Intergenic