ID: 1118329605

View in Genome Browser
Species Human (GRCh38)
Location 14:64805121-64805143
Sequence ACACTGACCCTGCCAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118329605_1118329616 28 Left 1118329605 14:64805121-64805143 CCTGAGGTTGGCAGGGTCAGTGT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1118329616 14:64805172-64805194 GCCCAGGGTACCCCCATGCTTGG 0: 1
1: 1
2: 2
3: 21
4: 161
1118329605_1118329611 -6 Left 1118329605 14:64805121-64805143 CCTGAGGTTGGCAGGGTCAGTGT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1118329611 14:64805138-64805160 CAGTGTGACATGGGGCCAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 220
1118329605_1118329614 13 Left 1118329605 14:64805121-64805143 CCTGAGGTTGGCAGGGTCAGTGT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1118329614 14:64805157-64805179 GGGGTTTTACCTTAAGCCCAGGG 0: 1
1: 0
2: 1
3: 4
4: 106
1118329605_1118329610 -7 Left 1118329605 14:64805121-64805143 CCTGAGGTTGGCAGGGTCAGTGT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1118329610 14:64805137-64805159 TCAGTGTGACATGGGGCCAAGGG 0: 1
1: 1
2: 3
3: 20
4: 182
1118329605_1118329609 -8 Left 1118329605 14:64805121-64805143 CCTGAGGTTGGCAGGGTCAGTGT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1118329609 14:64805136-64805158 GTCAGTGTGACATGGGGCCAAGG 0: 1
1: 0
2: 1
3: 19
4: 180
1118329605_1118329613 12 Left 1118329605 14:64805121-64805143 CCTGAGGTTGGCAGGGTCAGTGT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1118329613 14:64805156-64805178 AGGGGTTTTACCTTAAGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118329605 Original CRISPR ACACTGACCCTGCCAACCTC AGG (reversed) Intronic
900790720 1:4678412-4678434 TCACAGACCCGGCCAACATCTGG - Intronic
902393192 1:16118215-16118237 ACATTAACCCTGCCTCCCTCAGG - Intergenic
902515630 1:16988008-16988030 ATCCTGACCCTGCCACTCTCCGG - Intronic
908324659 1:63012010-63012032 ACACTAACACTGCCAATTTCTGG - Intergenic
910843599 1:91584959-91584981 ACACTTGTCCTGCCAACCTCTGG - Intergenic
911596881 1:99808026-99808048 ACACTATCCTTCCCAACCTCTGG - Intergenic
911760297 1:101606349-101606371 ACACCCACCCTGCCATCCTGGGG + Intergenic
915183339 1:154082504-154082526 TCACTGAGCATGCCATCCTCTGG - Intronic
916788286 1:168102420-168102442 ACACAGACCCTGCCCACCAGGGG - Intronic
920446455 1:206022184-206022206 ACACTGGCTCCTCCAACCTCTGG - Exonic
923519711 1:234726043-234726065 CCCCTGGCTCTGCCAACCTCTGG - Intergenic
924130917 1:240907168-240907190 ACACTGACCTTGACATCCTGGGG + Intronic
1063391435 10:5652321-5652343 ACACTGGCCCTGCACACCCCTGG - Intronic
1064864547 10:19864895-19864917 TCACTTACCCTCCCAAACTCAGG - Intronic
1070272348 10:74968556-74968578 ACAATGAGCCTGCCAAAGTCAGG + Intronic
1072375214 10:94808583-94808605 TCACTGTCCCTCCCAGCCTCTGG + Intronic
1074104777 10:110381183-110381205 ACCCAGACCCTGCCCACATCTGG - Intergenic
1076448313 10:130534395-130534417 AGACTGACCATGCCAAGCCCTGG - Intergenic
1076505240 10:130968340-130968362 ACACTGACCCTTCCATCTTACGG + Intergenic
1076684232 10:132189889-132189911 ATCCTGCCCCTGCCAAGCTCTGG + Intronic
1077096724 11:802138-802160 ACACTGCCCCTGCCATGCCCTGG + Intronic
1077233852 11:1470590-1470612 ACCTTGACCCTGCCACCCTCAGG + Intronic
1078005958 11:7532457-7532479 CTACTGATCCTGCCAACCTTGGG + Intronic
1078455132 11:11469021-11469043 ACACTGTCCCTACCAAACCCTGG - Intronic
1080948228 11:36998844-36998866 CCACTGCCCCTGCCAACCTTTGG + Intergenic
1089256692 11:117197988-117198010 TCCCTGACCCTGCAGACCTCTGG - Intergenic
1092765871 12:11852284-11852306 ACCCAGCCCCTGCCATCCTCTGG + Intronic
1094406315 12:30119981-30120003 CCACTGCCCCTGCCAGGCTCTGG + Intergenic
1098078310 12:66757244-66757266 ACACTGCCTCTCCCAGCCTCTGG + Intronic
1101146363 12:101844499-101844521 ACACAGACTCTCCTAACCTCTGG - Intergenic
1101250712 12:102931942-102931964 ACACAGCCCCTGCCATCCTGGGG + Intronic
1101776779 12:107802448-107802470 CCCCTGACCCCGCCAACTTCAGG - Intergenic
1104976248 12:132553231-132553253 ACACAGACCCTGCCCACACCGGG + Intronic
1107168382 13:37310727-37310749 ACACTGATACTGCCTACTTCTGG + Intergenic
1107655878 13:42591669-42591691 ACACTGACCTTGCAATCCACAGG - Intronic
1108317089 13:49247627-49247649 ACACTGACCATGACAGCCTGGGG + Intergenic
1110950500 13:81483371-81483393 CCACTGCCCTTCCCAACCTCTGG - Intergenic
1111020794 13:82447414-82447436 TCAATGACCCTGTCAAGCTCAGG - Intergenic
1111772926 13:92622187-92622209 ACCCTGTCCCTGCCAGGCTCTGG + Intronic
1112576060 13:100637644-100637666 AGAATGACCCTGCTCACCTCTGG - Exonic
1112818947 13:103308591-103308613 ACACTAAGCCTGCAAAGCTCAGG - Intergenic
1116445140 14:45000350-45000372 TCACTGCCCTTGCCAGCCTCTGG + Intronic
1117068880 14:52038539-52038561 ACAGTGTCCCTGCCAAAGTCAGG - Intronic
1118329605 14:64805121-64805143 ACACTGACCCTGCCAACCTCAGG - Intronic
1122062754 14:99147632-99147654 CCACAGCTCCTGCCAACCTCTGG + Intergenic
1124031759 15:26018430-26018452 ACACTTACTCTGCAAACCACAGG - Intergenic
1126810136 15:52394107-52394129 ACACTAAGCATGCCAACCACGGG + Intronic
1127288756 15:57552384-57552406 GCATTTACCCTGCAAACCTCTGG - Intergenic
1128668108 15:69553393-69553415 AAACAGACCCTTCCAAACTCAGG - Intergenic
1128704639 15:69829854-69829876 ACACAGCCTCTGCCAACCTTGGG + Intergenic
1129047864 15:72752765-72752787 TCACTGACCATGCCCACATCAGG + Exonic
1129920671 15:79316652-79316674 ACCCTGACCCATCCCACCTCTGG - Intronic
1130182362 15:81643433-81643455 ACACTGACCCTGCCAACCAAGGG - Intergenic
1130845283 15:87738381-87738403 AGACTGACCCTGCCAATGTCAGG + Intergenic
1132909004 16:2298977-2298999 TCACTGACCCTGTCAAGCTTGGG + Intronic
1132929517 16:2451737-2451759 ACGCTGACCCTCCCTCCCTCGGG + Intronic
1134756822 16:16674565-16674587 CCACTTTCCCTGCCAACGTCAGG - Intergenic
1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG + Intergenic
1135548452 16:23380801-23380823 ACCCTGCCCCTGCCCACCCCGGG + Exonic
1136028110 16:27482943-27482965 ACAGTGCCCCTGCCAGCCTTAGG - Intronic
1136188360 16:28601111-28601133 CCCCTGAACCTGCCCACCTCAGG + Intergenic
1138315207 16:56063984-56064006 ACCCTTACCCAGCCAGCCTCAGG + Intergenic
1138412627 16:56851990-56852012 CCACTGACCCTACCACACTCGGG + Intergenic
1139013939 16:62667094-62667116 TCAATGACCCTGCCAATCCCAGG - Intergenic
1140931714 16:79634091-79634113 CCCCTGACCCAGCCAACCTAAGG - Intergenic
1141699729 16:85636845-85636867 ACGCTGACCCTGCCTCCCTGTGG + Intronic
1142259633 16:89036663-89036685 ACTGTCCCCCTGCCAACCTCAGG + Intergenic
1143012914 17:3876124-3876146 ACAAAGACCCTGGCACCCTCAGG + Intronic
1144457423 17:15430471-15430493 ACGCTGACCCTGTCAAACTTAGG - Intergenic
1147724821 17:42560345-42560367 ACAATGTCCCTGCCATCCTGGGG - Intergenic
1149109023 17:53004085-53004107 CCACTACCCTTGCCAACCTCTGG - Intergenic
1149774341 17:59345499-59345521 ACACTGACTCTACTAATCTCAGG - Intronic
1149840058 17:59954541-59954563 ACATTCAACCAGCCAACCTCTGG - Intronic
1150059447 17:62052413-62052435 ACTCTGTCACTGACAACCTCTGG + Intronic
1150416652 17:64994058-64994080 AAGCTGACCCAGCCACCCTCCGG + Intergenic
1150795007 17:68229823-68229845 AAGCTGACCCAGCCATCCTCCGG - Intergenic
1152071973 17:78138504-78138526 AAACTGCCCCTGCCAGCCTCTGG - Intronic
1152657553 17:81527128-81527150 ACCATGGCCCTGCCCACCTCTGG + Intergenic
1152756012 17:82087359-82087381 ACATCGACCCTGCCACCCACAGG - Exonic
1152784639 17:82241414-82241436 ACACAGACCCAGCCAGACTCAGG + Intronic
1159596432 18:70386901-70386923 ACACAGACCCTGCCACTCTATGG + Intergenic
1160890945 19:1378497-1378519 AGAGTGACCCTGCCATCCCCAGG + Intergenic
1160966872 19:1750530-1750552 CCTCTGGTCCTGCCAACCTCAGG - Intergenic
1161201064 19:3015132-3015154 ACCCTGAGCCTGCCAGTCTCCGG + Intronic
1161515365 19:4693318-4693340 ACACTGACAGTGTCAGCCTCGGG - Intronic
1161805594 19:6441437-6441459 ACCCAGACCCTGCCTCCCTCAGG - Exonic
1162730434 19:12715350-12715372 ACCCTGACCCTGCCCACTCCAGG + Intronic
1162907372 19:13831733-13831755 ACACTGCCCCTTCCAACCTGGGG + Exonic
1163349277 19:16765126-16765148 TCACGGACCAGGCCAACCTCAGG - Exonic
1165474609 19:36023346-36023368 ACACTGCCCCTTCCTGCCTCTGG + Intronic
1166070375 19:40383822-40383844 ACCCTGACGCTGCCAACCCCTGG - Exonic
925487594 2:4353222-4353244 ACACTGACCCACCCAAAATCTGG + Intergenic
926355896 2:12040387-12040409 AAACTAACCCTGCCAACACCAGG - Intergenic
926890582 2:17635914-17635936 ACAGTGACCATGTCAAACTCTGG - Intronic
928090423 2:28370506-28370528 GCACTGACTCAGCCAGCCTCTGG + Intergenic
929889431 2:45906887-45906909 ACACTGTCCCAGCCAAGCGCAGG - Intronic
932691160 2:73914884-73914906 CCACAGTCCCTGCCAATCTCAGG + Intronic
932748768 2:74357460-74357482 ACCCTGCCCCTGCCAACTGCCGG + Intronic
935309965 2:101773737-101773759 ACACTTACCTTCCCAGCCTCTGG + Intronic
935331376 2:101980129-101980151 AGACTGACCCTGCAGACCCCGGG - Intergenic
935385823 2:102499156-102499178 TCAGTGTCCCTGCCAAGCTCAGG + Intronic
935622414 2:105141759-105141781 AATCTGTCCCTGACAACCTCAGG - Intergenic
938092913 2:128444807-128444829 ACTCTGCCCCAGCCAACCACAGG - Intergenic
939105785 2:137946937-137946959 ACACGGAACCTGCCAATATCTGG + Intergenic
940005365 2:149005232-149005254 ACCCTGACCATGCCCACCCCTGG - Intronic
940104296 2:150080762-150080784 ACACATACCCTTCCAGCCTCTGG - Intergenic
940785399 2:157975785-157975807 CCACTAACCTTCCCAACCTCTGG + Intronic
941007350 2:160261599-160261621 ACATGGACACTGCCAACCTGTGG + Intronic
941030451 2:160505378-160505400 ACACTGTCCCTGACATCCTGAGG - Intergenic
941890819 2:170579639-170579661 ACAATGGCCCTGACAACTTCTGG - Intronic
942211030 2:173670420-173670442 ACACTGACACTGAGAAGCTCGGG + Intergenic
942942992 2:181641041-181641063 ACTCTGACCCTGTGAACGTCTGG - Intronic
945526643 2:210896189-210896211 GCACTAATCTTGCCAACCTCAGG - Intergenic
946404115 2:219483698-219483720 CCGCTGACCTTGCCATCCTCGGG - Exonic
1169194108 20:3674183-3674205 TCCCTGACCCCGCCAACCCCTGG + Intronic
1170269226 20:14505723-14505745 ATGCTGACCCTGCCAATCTGGGG + Intronic
1170914701 20:20611320-20611342 ATAGTAACCCTGCCAAGCTCTGG + Exonic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1171381686 20:24738374-24738396 ACACTGGCCCTCCCGACCCCAGG + Intergenic
1171852740 20:30319980-30320002 AAACAGAATCTGCCAACCTCTGG - Intergenic
1172122684 20:32608080-32608102 TCACTGGCCCTGCCTTCCTCCGG + Intronic
1173721067 20:45258585-45258607 ACAGGGACCCTGCGCACCTCTGG + Intergenic
1173984462 20:47250359-47250381 CCACTGTGCCTGCCACCCTCTGG + Intronic
1174109936 20:48192054-48192076 ACACTCACCTTGCCAACCCATGG - Intergenic
1175608142 20:60328304-60328326 ACAGTGTCCCTGCCACACTCTGG - Intergenic
1175744378 20:61445155-61445177 AGCCTGACCCTGGCCACCTCTGG + Intronic
1175923546 20:62461274-62461296 CCACTTTGCCTGCCAACCTCCGG + Intergenic
1179190242 21:39117039-39117061 GCAATGACCCTGCCGGCCTCTGG + Intergenic
1182086400 22:27564053-27564075 ACAGTGCCCCTGCCACCCCCTGG + Intergenic
1183548631 22:38468557-38468579 GCAGTGACACTGCCAACCTGAGG - Intronic
1184641980 22:45877686-45877708 ACACTGCACCTGCCACCCTGGGG + Intergenic
1185393583 22:50575757-50575779 TCACTGCCCCTGCCCAGCTCGGG - Intronic
950393495 3:12715588-12715610 ACACTGACGCTGCCAGTCCCTGG - Intergenic
950404436 3:12796139-12796161 AAACTGACCCTGCCGTCCTGAGG + Intergenic
950571116 3:13800652-13800674 AGCCTGAGCCTGCCAAGCTCTGG - Intergenic
951595611 3:24315245-24315267 ACACTTACCCTGCTGTCCTCTGG + Intronic
953280811 3:41554539-41554561 ACACTTACCCTCCCAGCCTCTGG - Intronic
955484786 3:59424442-59424464 ACACTGTCCCTTACAGCCTCGGG - Intergenic
956018309 3:64907774-64907796 ACCCTGTCCCTGCCATCCTAGGG - Intergenic
956414254 3:69011148-69011170 ACAATGATCCTGCCATTCTCAGG + Intronic
959114128 3:102155968-102155990 ACACTGTCCTTCCCAGCCTCTGG - Intronic
962606996 3:137040576-137040598 ACCCTGACCCTGAGAAGCTCTGG - Intergenic
965793010 3:172410274-172410296 ACACTTACCCTGCTAAGATCAGG + Intergenic
966626914 3:182027030-182027052 ACACTTACCCTGCCAACGATTGG + Intergenic
972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG + Intergenic
979143128 4:117203554-117203576 CCACTGCCCTTGCCAGCCTCTGG - Intergenic
980103946 4:128569132-128569154 ATACTCACCCTACCAACCTCAGG - Intergenic
986076710 5:4345222-4345244 ACACAGACCTTGCCTACCTTTGG - Intergenic
986270719 5:6228410-6228432 TCACTGTCCCCGCCACCCTCTGG + Intergenic
988280794 5:29143923-29143945 ATTCTGACACTGCCAACCTGGGG - Intergenic
988612205 5:32737338-32737360 ATGCTCACCCTGCCAATCTCAGG + Intronic
992950698 5:81854696-81854718 ATACTGCCCCTGCCTGCCTCAGG + Intergenic
994147485 5:96411175-96411197 ACTCTGGCCCTGCCAGTCTCTGG + Intronic
998406102 5:141875751-141875773 ACACTGCCTCTGGCTACCTCTGG + Intronic
998569024 5:143240412-143240434 ATACTGGCAATGCCAACCTCTGG - Intergenic
999319468 5:150604472-150604494 ACACTGCCCCTACCAAACCCAGG - Intronic
999480712 5:151945661-151945683 ACACAGTCCCTGCCTTCCTCGGG - Intergenic
1001698992 5:173693116-173693138 CCTCTTTCCCTGCCAACCTCAGG + Intergenic
1002014906 5:176313287-176313309 TCACTGAACCTATCAACCTCAGG - Intronic
1002055862 5:176597601-176597623 TCACTGCCCCTGGCACCCTCGGG + Exonic
1002308532 5:178298518-178298540 ACAGTGACCCTGGCAGCCTCAGG - Intronic
1002618453 5:180469664-180469686 ACACTGCACCTGGTAACCTCAGG + Intergenic
1003136145 6:3435953-3435975 AAACTGACCCTGCCCACACCTGG + Intronic
1006830982 6:36968219-36968241 ACACTGATCTGCCCAACCTCTGG + Exonic
1010363218 6:75018891-75018913 ACACTACCCTTGCCAGCCTCTGG + Intergenic
1011704862 6:89990635-89990657 CCACCGACCCCTCCAACCTCTGG + Intronic
1011733301 6:90288560-90288582 ACAGTGACCCTGCAAACCTGAGG + Intronic
1014809685 6:125871196-125871218 ACACTGACCTTTCCAACTTCAGG - Intronic
1015103488 6:129508513-129508535 CCACTAACCTTCCCAACCTCTGG + Intronic
1016065153 6:139674502-139674524 AAACTGTCCTTCCCAACCTCTGG - Intergenic
1017027806 6:150197156-150197178 TCTCTGCCCCTGCCTACCTCAGG + Intronic
1017032771 6:150238607-150238629 ACACAGGCCCTGCCAACATATGG - Intronic
1017561806 6:155636301-155636323 ACAGTGGCCCTGCCTCCCTCTGG - Intergenic
1017928336 6:158930028-158930050 ACACCCACCCTGCCAACCATAGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020394606 7:7700235-7700257 ACCCTGACCCTTCCAACATGTGG - Intronic
1021196634 7:17681270-17681292 TCACTGTCTCTGTCAACCTCAGG - Intergenic
1022843831 7:34190596-34190618 TCACTGATTCTGCCATCCTCAGG + Intergenic
1023794711 7:43782220-43782242 TCACTGACCCTCCCAAGCTCTGG - Intronic
1028365703 7:90028274-90028296 CCACTGCCCCTCCCAACCTCTGG - Intergenic
1032890685 7:136191837-136191859 ACACTGCCACTGCCTCCCTCTGG + Intergenic
1034900257 7:154903804-154903826 TCACTGACCTTGCCGGCCTCTGG - Intergenic
1035935899 8:3838178-3838200 ACACAGACCCTGCCTTCCTATGG + Intronic
1037390399 8:18386744-18386766 TCTCTGACTCTGCAAACCTCTGG + Intergenic
1039411967 8:37362414-37362436 AAACTCACCCTCCCACCCTCTGG - Intergenic
1040600182 8:48875588-48875610 ACACTGACACAGCCAAGCTATGG - Intergenic
1043331598 8:79123648-79123670 ACACAGACCCTGTCATTCTCAGG - Intergenic
1048037635 8:130692709-130692731 GCTCTGACTCTGCCAAGCTCAGG - Intergenic
1048586632 8:135780155-135780177 ACACTGACCCTGACATATTCAGG - Intergenic
1049159017 8:141085596-141085618 ACGCTGACCTTGCCAATGTCTGG + Intergenic
1049614928 8:143571931-143571953 AGCCTGACCCTGCCATCTTCAGG - Intronic
1049787044 8:144456000-144456022 GCAGTGACCCTGCCCTCCTCTGG + Intronic
1049987334 9:963658-963680 AAACTGAACCTGCCAAGCTTCGG + Intronic
1051811184 9:21052050-21052072 ATACTGACCCAACCCACCTCAGG - Intergenic
1053790535 9:41683265-41683287 AAACAGAATCTGCCAACCTCTGG - Intergenic
1054154623 9:61631541-61631563 AAACAGAATCTGCCAACCTCTGG + Intergenic
1054178880 9:61894964-61894986 AAACAGAATCTGCCAACCTCTGG - Intergenic
1054474399 9:65562617-65562639 AAACAGAATCTGCCAACCTCTGG + Intergenic
1054658657 9:67685867-67685889 AAACAGAATCTGCCAACCTCTGG + Intergenic
1057878499 9:98775529-98775551 ATACTAACAGTGCCAACCTCAGG + Intronic
1060726059 9:126006678-126006700 ACCCTGACCCTGGAAACATCTGG + Intergenic
1061211816 9:129198092-129198114 GCACTGGCCCTGCCTCCCTCAGG - Intergenic
1061836146 9:133331563-133331585 TCCCTGACCCTGCAAACCTCGGG + Exonic
1061886542 9:133593822-133593844 CCACTGGCCCTGCCAGCCCCTGG - Intergenic
1062034886 9:134378613-134378635 TCCCTGCCCCTGCCAGCCTCAGG + Intronic
1062137902 9:134939303-134939325 GCACTCACCCTGCCACCCCCAGG + Intergenic
1186555799 X:10557095-10557117 ACATGGACCCAGACAACCTCGGG - Intronic
1187793098 X:22972127-22972149 ACACTGTCCTTCCCAGCCTCTGG - Intergenic
1190265246 X:48824144-48824166 ACACTCACACCCCCAACCTCAGG + Exonic
1192477437 X:71455122-71455144 TCCCTGACCCAGCCATCCTCTGG + Intronic
1195216927 X:102712272-102712294 ATCCTGGCCCTGCCCACCTCGGG + Exonic
1199156572 X:144555953-144555975 GCACTACCCTTGCCAACCTCTGG - Intergenic