ID: 1118329657

View in Genome Browser
Species Human (GRCh38)
Location 14:64805489-64805511
Sequence TAGTGTTAAGTGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118329657_1118329663 13 Left 1118329657 14:64805489-64805511 CCCACCTCCTTCACTTAACACTA 0: 1
1: 0
2: 1
3: 21
4: 212
Right 1118329663 14:64805525-64805547 GAGCCAGTATAAATGGCGCTTGG 0: 2
1: 0
2: 0
3: 4
4: 50
1118329657_1118329667 19 Left 1118329657 14:64805489-64805511 CCCACCTCCTTCACTTAACACTA 0: 1
1: 0
2: 1
3: 21
4: 212
Right 1118329667 14:64805531-64805553 GTATAAATGGCGCTTGGGTTGGG 0: 2
1: 0
2: 0
3: 2
4: 44
1118329657_1118329666 18 Left 1118329657 14:64805489-64805511 CCCACCTCCTTCACTTAACACTA 0: 1
1: 0
2: 1
3: 21
4: 212
Right 1118329666 14:64805530-64805552 AGTATAAATGGCGCTTGGGTTGG 0: 2
1: 0
2: 2
3: 2
4: 64
1118329657_1118329664 14 Left 1118329657 14:64805489-64805511 CCCACCTCCTTCACTTAACACTA 0: 1
1: 0
2: 1
3: 21
4: 212
Right 1118329664 14:64805526-64805548 AGCCAGTATAAATGGCGCTTGGG 0: 2
1: 0
2: 0
3: 3
4: 73
1118329657_1118329662 6 Left 1118329657 14:64805489-64805511 CCCACCTCCTTCACTTAACACTA 0: 1
1: 0
2: 1
3: 21
4: 212
Right 1118329662 14:64805518-64805540 CCTTTAAGAGCCAGTATAAATGG 0: 2
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118329657 Original CRISPR TAGTGTTAAGTGAAGGAGGT GGG (reversed) Intronic
902052083 1:13571693-13571715 TAGTGTTGGGTGATGGAGGCTGG - Intergenic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904963164 1:34350569-34350591 CAGTGGTAAGTGTAGGGGGTAGG + Intergenic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
908057221 1:60301231-60301253 TAATGTTAAGTGTGGGAGTTTGG + Intergenic
910152310 1:84164711-84164733 TAGTGGTATATGAAGGAGGCTGG + Intronic
910523934 1:88155884-88155906 TAGTGTGAAGTGGAGGATGGAGG - Intergenic
912017218 1:105055800-105055822 TAGAGTTAAATGTAGAAGGTAGG - Intergenic
912247420 1:107974669-107974691 TTATGCTAAGTGAAAGAGGTTGG + Intergenic
912623462 1:111188824-111188846 AAGTGTGGAGTGAAGGTGGTTGG + Intronic
912760202 1:112359663-112359685 TGGTGTTCAGTGATGGAGGAGGG + Intergenic
913592006 1:120338596-120338618 TAGACTTCATTGAAGGAGGTGGG - Intergenic
913651350 1:120916550-120916572 TAGACTTCATTGAAGGAGGTGGG + Intergenic
914169758 1:145212520-145212542 TAGACTTCATTGAAGGAGGTGGG - Intergenic
914322099 1:146575084-146575106 AAGTGTTAATTCAGGGAGGTTGG - Intergenic
914524873 1:148456482-148456504 TAGACTTCATTGAAGGAGGTGGG - Intergenic
914598803 1:149179351-149179373 TAGACTTCATTGAAGGAGGTGGG + Intergenic
914641528 1:149610652-149610674 TAGACTTCATTGAAGGAGGTGGG + Intergenic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
916810616 1:168302345-168302367 AAGTATTAAGCGAAGGCGGTGGG + Intronic
920758091 1:208754655-208754677 TACTGTTAAATGAATGACGTGGG - Intergenic
920853638 1:209646386-209646408 ATGTGTGAAGTGAAGGAGCTGGG - Intronic
921869554 1:220124851-220124873 TAGTTTTGAGGGAATGAGGTTGG + Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922403563 1:225286953-225286975 TATTGCTAAGTGAAAGAAGTCGG + Intronic
923115451 1:230932946-230932968 TTGTGTTATGAAAAGGAGGTAGG - Intronic
923990124 1:239427003-239427025 CAGAGGTGAGTGAAGGAGGTGGG + Intronic
924310323 1:242734675-242734697 TAGGGTTGGGGGAAGGAGGTGGG + Intergenic
1063725556 10:8633831-8633853 TAGTGCTAAGTGAAAGAAGCTGG + Intergenic
1064333084 10:14412190-14412212 TAGTAACAAGTGCAGGAGGTAGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064471100 10:15636846-15636868 TAGTGAAAAATGAAAGAGGTCGG + Intronic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1065475082 10:26127144-26127166 TATTTTTAAGTGAAGGAAATAGG - Intronic
1065772019 10:29086429-29086451 AAGTCTGCAGTGAAGGAGGTGGG - Intergenic
1068279278 10:54848006-54848028 CAGTGTTAAGTGAAGTATTTGGG + Intronic
1070284753 10:75074672-75074694 TTGTGTTAAGTGAAAGATGTGGG - Intergenic
1072354774 10:94597498-94597520 TCGTGTTAAGTAAAGGATGAAGG - Intronic
1073302855 10:102481456-102481478 TAGTGATAGGTGAAGGAGGTTGG - Intronic
1074153591 10:110779931-110779953 TAATGTTAAGTGAAAAAGGCAGG - Intronic
1075628623 10:123985308-123985330 TAATGTTCAGTGTTGGAGGTGGG - Intergenic
1076499168 10:130922552-130922574 TAGTATTCTGTGAAGGAAGTAGG - Intergenic
1076820944 10:132939310-132939332 GAGTGTGAAGTGGAGGAGGGTGG + Intronic
1078410523 11:11112562-11112584 AAGTGTTAATTAAAGGAGGTGGG + Intergenic
1079305703 11:19319473-19319495 GAGTATTAAGTGTGGGAGGTAGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1081993183 11:47348347-47348369 TAGTGTTGGGAAAAGGAGGTAGG + Intronic
1082772863 11:57222052-57222074 AAGTCTTCAGTGAAGGAGGAAGG - Intergenic
1082871268 11:57945390-57945412 TAATTTAAAGGGAAGGAGGTGGG - Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083082149 11:60105023-60105045 TAGTGTTGGGAGACGGAGGTTGG + Intergenic
1083397151 11:62399963-62399985 GAGAGTTCAGGGAAGGAGGTGGG - Intergenic
1085004480 11:73072821-73072843 TAGTGTTATGTGCATGTGGTGGG - Intronic
1087924912 11:103908778-103908800 TGGTGTTCAGTGAAAGATGTGGG - Exonic
1089318499 11:117608513-117608535 TAATGTTAAGTGAAGTAAGCAGG - Intronic
1089556604 11:119318736-119318758 TGGTGTTAAGTGAAGGAAGGGGG - Intronic
1089922923 11:122227952-122227974 TAGGTTTAAGGGATGGAGGTGGG - Intergenic
1093355093 12:18157240-18157262 TATTGTTAACTGAAGGAGTTTGG - Intronic
1093755419 12:22846554-22846576 TAGTATTAAGTGGTGGGGGTGGG - Intergenic
1097033764 12:56108263-56108285 GAGTGTTAAGTGAAAGAACTTGG - Intronic
1098265693 12:68716746-68716768 TAGTGTGATGTGTAGGAGTTTGG + Intronic
1100147930 12:91699983-91700005 TACTTTGAACTGAAGGAGGTTGG - Intergenic
1100250780 12:92821048-92821070 AAGTCTTCAGTGAATGAGGTAGG - Intronic
1100396871 12:94193364-94193386 TAGTGGTGAGGGAAGGAAGTGGG + Intronic
1100463396 12:94822961-94822983 GAGTGTTAGGTGAAGCAGGGCGG + Intergenic
1101393718 12:104325189-104325211 TAATGTTAAGTGAGGGAGATGGG + Intronic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1107017526 13:35719638-35719660 TAGTGTTGTGGCAAGGAGGTTGG - Intergenic
1109267685 13:60219924-60219946 GATTATTAAGTGAAGGGGGTGGG + Intergenic
1109327856 13:60891042-60891064 TAGTTTTAAGAGAAAGAGGGAGG + Intergenic
1110315919 13:74106464-74106486 TAGTGTTGAGTAAAAGAAGTGGG - Intronic
1110500818 13:76225844-76225866 TAAAGATAAGTGAAGGAGATTGG - Intergenic
1113266804 13:108627919-108627941 TTGTATTAAGAGAAGGGGGTAGG + Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118572384 14:67206594-67206616 AAATGTTAAGTGAAAAAGGTAGG + Intronic
1119517160 14:75257378-75257400 AAGTGTTTAGGGAAGGATGTCGG + Intronic
1120004783 14:79344180-79344202 AAGTTTTAAGTGAAATAGGTGGG + Intronic
1120616791 14:86716261-86716283 CAGTCTTAAGTGGAGGAGATGGG + Intergenic
1121896019 14:97648555-97648577 TATTGTGAAGTGATGGAGGAAGG - Intergenic
1122299403 14:100723404-100723426 TAGTGTTTAGAAAAGGAGGAGGG + Intergenic
1125436960 15:39656452-39656474 TAGTTTTAGAGGAAGGAGGTTGG - Intronic
1126518975 15:49567716-49567738 TAGTGTGAAATGAAGATGGTAGG - Intronic
1127652191 15:61020252-61020274 GAATGTTAAGTGACAGAGGTGGG - Intronic
1127976458 15:64000803-64000825 GAGTGTAAAATGAAGGTGGTGGG + Intronic
1128552207 15:68605551-68605573 TCGTGCTAAGTGAAAAAGGTGGG + Intronic
1128629751 15:69252537-69252559 TAATGTTCAGTGTTGGAGGTGGG - Intronic
1128927918 15:71675656-71675678 GAGGGTTAGATGAAGGAGGTGGG - Intronic
1129209585 15:74059923-74059945 TAAAGTTAAGTGAGGGAGGAGGG + Intergenic
1129835697 15:78704101-78704123 TAAAGTTAAGTGAGGGAGGAGGG - Intronic
1130927532 15:88396652-88396674 TTGTGTTAGGTTAAGGAGGGAGG + Intergenic
1131029835 15:89177324-89177346 CACTGTAAAATGAAGGAGGTGGG + Intronic
1131294897 15:91139187-91139209 TGGTGTGAAGGGAAGGAGGTTGG + Intronic
1134206393 16:12241783-12241805 TAGTGTTGAGAGAAAGAGATGGG - Intronic
1136383154 16:29906440-29906462 TAGTACAAAGTTAAGGAGGTAGG + Exonic
1137704066 16:50521740-50521762 ATGTGTCAAGTGAAGGAGGGTGG - Intergenic
1138813582 16:60178592-60178614 TAATGTTAATAGACGGAGGTGGG - Intergenic
1139659776 16:68412564-68412586 GTGTGTTAAATGAAGCAGGTAGG - Intronic
1139771567 16:69281089-69281111 TACTGTTAAGAGAATGAGGCCGG - Intronic
1140011528 16:71136081-71136103 AAGTGTTAATTCAGGGAGGTTGG + Intronic
1141229291 16:82149829-82149851 TGGTGGTGAGTGGAGGAGGTGGG + Intronic
1147568736 17:41553761-41553783 TCGTGCTAAGAGCAGGAGGTAGG + Intergenic
1148590898 17:48816277-48816299 TTGTTTTAAGAGATGGAGGTGGG - Intronic
1149817788 17:59743372-59743394 TATTGCAAAGTGAAAGAGGTCGG - Intronic
1152231232 17:79115104-79115126 TAGTGGAAAGTGAAGGAGACGGG - Intronic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1159863151 18:73672982-73673004 TAATGTCAAGTGGAGGAGGACGG - Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1166345944 19:42165839-42165861 GAGTAGTAAGTGAAGGTGGTGGG + Intronic
1168477007 19:56683657-56683679 CATTTCTAAGTGAAGGAGGTGGG - Intergenic
925934201 2:8737901-8737923 TTATGTTAAGTGAAAGAAGTTGG - Intronic
926443979 2:12921559-12921581 TAGTGTGACTTGAAGGATGTGGG + Intergenic
927127228 2:20022909-20022931 TGGTGTGGAGAGAAGGAGGTGGG - Intergenic
928184614 2:29098481-29098503 TATTGTTAAGTGAAGAAGCTAGG - Intronic
928647584 2:33370986-33371008 TACTGGTAGGTGCAGGAGGTAGG + Intronic
929471617 2:42199454-42199476 TAGTTATAAGTAAAGGAGGAAGG + Intronic
929507562 2:42540110-42540132 TTGAGTCAGGTGAAGGAGGTGGG + Intronic
931403888 2:61957061-61957083 TAGTTTTAATTGAAGGAAGATGG + Intronic
931982438 2:67708447-67708469 TATTGTAAAGTGAAGGAAGTAGG + Intergenic
933405536 2:81853314-81853336 TAGTGTAATGTGAAGGAAATGGG - Intergenic
935031513 2:99327369-99327391 TAGTATTAAGTTAAGCAGGCAGG - Intronic
935721431 2:105982754-105982776 TAGTGTTGGGTGAAAGAGGCTGG + Intergenic
937159829 2:119749750-119749772 TAGAATTAAGTGAAGGAATTTGG - Intergenic
939007802 2:136809390-136809412 TAGAGCTAAGTGAAGATGGTAGG + Intronic
939258618 2:139778054-139778076 TGGTGTGCAGTGAAGGAGGTGGG + Intergenic
939378933 2:141408833-141408855 TTGTGATAAGTGAAGGTGATAGG - Intronic
940690115 2:156906142-156906164 TAGTCTTAAATGAAAGAGTTGGG - Intergenic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
942337812 2:174909275-174909297 TTGTTTTAAGTGAAGGAAGAAGG - Intronic
942418753 2:175785722-175785744 TATTGTTAAGTGAAAAAGCTAGG + Intergenic
946439635 2:219684537-219684559 AAGTATTAAATGAGGGAGGTAGG - Intergenic
946959752 2:224971428-224971450 GGGTGTGAAGTGAAAGAGGTGGG + Intronic
947351249 2:229247934-229247956 GAGTAGTAAGAGAAGGAGGTGGG - Intronic
947687642 2:232103998-232104020 TAGTGTTAAAAAAAGGTGGTGGG - Intronic
948055471 2:235006885-235006907 TGGTGTTTAGTGAAGAAGATTGG + Intronic
1169513764 20:6294579-6294601 TAGTGTTAAGTGAAAAAAGCAGG - Intergenic
1170281004 20:14649064-14649086 GAGTGTGAAGTGAAGGAGTGTGG - Intronic
1170281262 20:14651510-14651532 GAGTAATAAGTGATGGAGGTAGG + Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1177819929 21:26020154-26020176 CTGTGTTAAGTGAAAGAAGTCGG + Intronic
1179670822 21:42946403-42946425 TAGTGTTGGGAGACGGAGGTTGG + Intergenic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
953261269 3:41341382-41341404 GAGTGTAAAATCAAGGAGGTAGG - Intronic
955609946 3:60746324-60746346 GAGAGATAATTGAAGGAGGTGGG + Intronic
955836597 3:63062258-63062280 TAGTATTCAGAGAAGGAGGTTGG - Intergenic
955959264 3:64322230-64322252 GAGTGTGAATGGAAGGAGGTAGG + Intronic
958269247 3:91478454-91478476 TAGTGTTAATTAAAGGACTTGGG - Intergenic
959099000 3:101989157-101989179 TAGTTTGAAGTGATGGAGGAGGG + Intergenic
959545061 3:107586151-107586173 TACTGTTAAGAGAATGATGTGGG - Intronic
959720531 3:109482148-109482170 TAGGGTTTATTGAAGGAGGAAGG + Intergenic
961129540 3:124453254-124453276 TGGTGTGAAGGAAAGGAGGTAGG - Intronic
961642595 3:128374000-128374022 TAATGGCCAGTGAAGGAGGTGGG - Intronic
962267865 3:133956145-133956167 TAGTGTTAAGCGAGTGAGATTGG - Intronic
962275360 3:134009325-134009347 TAATGTTAAGTAAAGAAGGCAGG - Intronic
962449772 3:135503289-135503311 TATTCTGAAGTGGAGGAGGTGGG + Intergenic
963574723 3:147045713-147045735 AAGAGGTAAGTGAAGGAGGTTGG - Intergenic
964178592 3:153856364-153856386 TAGTGTGAGGGGAAGCAGGTAGG - Intergenic
964278410 3:155034103-155034125 TACTGTTAAGTTGAGGAGGAAGG - Intronic
964301422 3:155289827-155289849 AAGTGTTAAGTGAAGAAGCCAGG - Intergenic
965891531 3:173519931-173519953 TAGTCTGAAGTGTTGGAGGTGGG + Intronic
967545507 3:190722047-190722069 TAGTGTTTAGTTAAGTATGTTGG - Intergenic
968290798 3:197538233-197538255 TAATGACAAATGAAGGAGGTAGG + Intronic
970583329 4:17492995-17493017 TAGTGGTAAGTGGAGGAACTGGG - Intronic
970912471 4:21293308-21293330 AACTCTTAAATGAAGGAGGTAGG + Intronic
971620016 4:28844330-28844352 TAGTCTTCAGTGTTGGAGGTGGG + Intergenic
973122972 4:46545675-46545697 AATTATTAAGTGAAGGAGGTAGG - Intergenic
974606043 4:64151825-64151847 TAGTGTGAAAGGAAGGATGTGGG - Intergenic
975289244 4:72657897-72657919 TATTGATAAGGGAAAGAGGTAGG - Intergenic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
977521557 4:98090769-98090791 TAGTGGTAAGTGGAGGAAGGGGG - Intronic
978766090 4:112406495-112406517 TAGTTTGAAGTAAAGGAGATTGG + Intronic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979623566 4:122822727-122822749 TATTGTTAATTGAAAGAAGTAGG - Intergenic
982121053 4:152144290-152144312 TACTTTGAACTGAAGGAGGTTGG + Intergenic
983531022 4:168809940-168809962 AAGTGTTAATAGAAGGAGGGTGG + Intronic
983577887 4:169277871-169277893 TAGTGTTAGGCAAAGGATGTTGG + Intergenic
983649254 4:170022416-170022438 CAGTGTCATGTGAAGGAGTTTGG - Intronic
984159390 4:176232755-176232777 TAGTCTTAAGAGAAAGATGTTGG - Intronic
984164175 4:176287850-176287872 TAGTATCAAGTGTAGGAGGGTGG + Intergenic
984712326 4:182896083-182896105 AAGTGTTACGTGTAGAAGGTTGG - Intronic
984912389 4:184686399-184686421 TAGTGTTAAGAGCTGGAGCTAGG + Intronic
986534013 5:8767647-8767669 TTGTCTAAAGTGAAGGAGTTAGG + Intergenic
989224709 5:39012264-39012286 GAGTGTTGAGTGAAGGGGGAAGG - Intronic
989983604 5:50670245-50670267 TAGACTTTATTGAAGGAGGTGGG + Intronic
990137343 5:52662347-52662369 TGGTGTTATGTGAAGGAAGTGGG - Intergenic
990140896 5:52702751-52702773 TATTGTTAAGTAAAGCAAGTAGG - Intergenic
993939166 5:94038390-94038412 TACTGTTAGCTTAAGGAGGTGGG - Intronic
993982869 5:94564066-94564088 TAGTGTCAAGTATAGGAGGTTGG - Intronic
993996146 5:94725618-94725640 GAGAGTTTAGAGAAGGAGGTGGG + Intronic
994276868 5:97849276-97849298 AAGTGTCAAATCAAGGAGGTGGG + Intergenic
998985435 5:147751516-147751538 AAGGGTTATGTGAAGGGGGTGGG - Intronic
999684042 5:154086547-154086569 TAGTTTTGAGAGAAAGAGGTGGG - Intronic
1002898302 6:1391618-1391640 AAGTGTTAAGAGGAGGGGGTGGG + Intronic
1004323994 6:14656917-14656939 TAATGTTGAGTGAAGGAAGCTGG - Intergenic
1004438532 6:15622676-15622698 TAGTGATCAGTGAAAGAGATAGG + Intronic
1005507325 6:26481168-26481190 TAGTATAAAATGAAGGAGGAAGG - Intergenic
1009657107 6:66561572-66561594 TAAAGTTAAGTGAAGGGGCTGGG - Intergenic
1010550521 6:77216705-77216727 TATTGATAAGTGAAGCTGGTTGG - Intergenic
1011489307 6:87874310-87874332 TACTTTGAACTGAAGGAGGTGGG - Intergenic
1012783141 6:103589166-103589188 TAGTTTTAACTGAAAGAGGTAGG - Intergenic
1014500842 6:122187036-122187058 TAATGTTAAGTGAAAGAGTGAGG - Intergenic
1021308162 7:19057359-19057381 TACTGATAAGTGAAAGAGTTTGG - Intronic
1024086939 7:45901421-45901443 TAGTTGTAGGGGAAGGAGGTGGG + Intergenic
1032062716 7:128738450-128738472 TAATGTTAAGTGAAGGGAATGGG - Intergenic
1033207517 7:139435711-139435733 TCGTGTTAAGGGAAGGAAGTCGG - Intergenic
1039390673 8:37178791-37178813 CAGTGCTCAGTGAAGGAGGAGGG + Intergenic
1042883931 8:73526197-73526219 TTATGTTAAATGAAGGAGTTGGG - Intronic
1044017287 8:87059590-87059612 AAGTGCAGAGTGAAGGAGGTTGG + Intronic
1044269119 8:90220008-90220030 TAATGGTAAGAGAATGAGGTTGG + Intergenic
1045295826 8:100871051-100871073 TCGTGTTGAGTGAATGAGGGAGG - Intergenic
1045637124 8:104204973-104204995 AAGTCTTAATTGAAGGAGGGAGG + Intronic
1047822068 8:128531768-128531790 TACTGGAAAGTCAAGGAGGTGGG - Intergenic
1052978844 9:34432328-34432350 CAGTGTTAAGTAGAGCAGGTAGG - Intronic
1053883905 9:42624118-42624140 TAGTGTTAAGTATAGGATATTGG + Intergenic
1053888763 9:42670176-42670198 TAGTGTTAAGTATAGGATATTGG - Intergenic
1054222925 9:62431564-62431586 TAGTGTTAAGTATAGGATATTGG + Intergenic
1054227785 9:62477623-62477645 TAGTGTTAAGTATAGGATATTGG - Intergenic
1054800658 9:69345154-69345176 AAGTGTCAGGTGAAGGAGGCTGG + Intronic
1054905421 9:70410691-70410713 TGGTGTTAAATCAAGAAGGTGGG - Intronic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057910780 9:99018737-99018759 TAATGTTAAGTGAAAGAAGCTGG + Intronic
1057926664 9:99158478-99158500 TCATGCTAAGTGAAGGAAGTGGG + Intergenic
1058304066 9:103414756-103414778 TAGTCTTAAGTGAATGAGCCAGG + Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1058748395 9:108015049-108015071 TAATTTTAAGTGAAGCAGGTTGG - Intergenic
1059149999 9:111940778-111940800 AAATGTTAAGTGAAAGAAGTTGG + Intergenic
1060377602 9:123131201-123131223 TAGTGTGAAGAACAGGAGGTAGG - Intronic
1062258662 9:135645355-135645377 TAGTGTCAAGTGCTGGAGGTAGG - Intergenic
1188479216 X:30620329-30620351 TAATCTTCAGTGTAGGAGGTGGG + Intergenic
1188659957 X:32746974-32746996 TACTGTTAAGTGAAATAAGTCGG - Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1189119211 X:38376053-38376075 TACTGCTAAGTGAAGGAAGAGGG + Intronic
1189400841 X:40667287-40667309 GATTGTGTAGTGAAGGAGGTGGG + Intronic
1191689072 X:63921434-63921456 TGGTGGTCAGTGAAGGAGGCGGG + Intergenic
1192926549 X:75760092-75760114 TGGTGTTCAGTGGAGGTGGTGGG - Intergenic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic