ID: 1118333528

View in Genome Browser
Species Human (GRCh38)
Location 14:64832754-64832776
Sequence TGGTGTGATGAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 651}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118333528 Original CRISPR TGGTGTGATGAGAGGGAAGA AGG (reversed) Intronic
900288110 1:1911455-1911477 TGGTGTGTTGGAAGGGCAGAGGG - Intergenic
900996011 1:6124109-6124131 TGGGGTGGTGGGAGGGAAGGTGG + Intronic
902376029 1:16030283-16030305 TGGTGAGAGGAGAGGGATAAGGG - Intronic
902380968 1:16052028-16052050 TGGTGAGAGGAGAGGGATAAGGG - Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
902834819 1:19040188-19040210 TGGTGTGTAGAGAGGAGAGATGG + Intergenic
903133637 1:21294772-21294794 TGGGGTGATGAGGTGGAAAAGGG + Intronic
903534257 1:24056313-24056335 TGGTGGGAGGAAAGGGAAGGAGG - Exonic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
904216829 1:28927653-28927675 GGGAGAGATGAGAGGAAAGAAGG - Intronic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
906207451 1:43994810-43994832 GGCTGTGATGTGGGGGAAGATGG + Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907454251 1:54565051-54565073 TGGGGTGGTGTGGGGGAAGACGG - Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
908437671 1:64122278-64122300 TGATGTGAGGATGGGGAAGAAGG + Intronic
909662938 1:78104165-78104187 TGGTGTGTAGAGGGGGGAGAGGG + Intronic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910550507 1:88468552-88468574 TGGTGTCATGAGAAGAAAAATGG + Intergenic
912742892 1:112217644-112217666 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
913057465 1:115175614-115175636 GGGTGAGATGAAAGGGAAGAAGG + Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914684677 1:149967859-149967881 TGGTGGGAGGAGAGGGAATAAGG + Intronic
915548780 1:156619546-156619568 TGTTGTGGGGAGAGGGGAGATGG + Intronic
915817915 1:158989824-158989846 TGCTCTGATGAAAAGGAAGATGG - Intergenic
916074643 1:161193417-161193439 TGGGGTGATGTGAGGAAGGAAGG - Intronic
916559950 1:165925997-165926019 TGGTGGCATGAGAGGGGAGGAGG + Intergenic
916953708 1:169809437-169809459 TGGTGTCAAGAGAAGCAAGAAGG - Intronic
917020944 1:170586198-170586220 TGCTTTGATGATAGGGCAGAGGG + Intergenic
917793071 1:178512288-178512310 AGTTGAAATGAGAGGGAAGAAGG + Intergenic
918121708 1:181546343-181546365 TGGAGTGATGAGAAGGAATTAGG + Intronic
918196849 1:182230879-182230901 TGGAGTGGTGAGAGGGGAGGTGG + Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918295123 1:183149438-183149460 TGGTGTGAGGAGAGGGGTGTGGG - Intergenic
918447519 1:184630025-184630047 TGGTGTGGTGAGAAGGAGGGAGG + Intergenic
919850750 1:201670576-201670598 TGGTTTGATGATAGAGATGATGG + Intronic
920031811 1:203042051-203042073 TGGAGTGATGAGAGGGGATTGGG + Intronic
921098769 1:211910447-211910469 TGGGGTGGTGAGAGTGAAGGTGG + Intergenic
921837625 1:219794418-219794440 AGGAGAGATGTGAGGGAAGAAGG + Intronic
922317543 1:224456196-224456218 TGGTGTGAGGAGAGGGGAGCAGG - Intronic
923287091 1:232506560-232506582 TGGTATCAAGAGAGGTAAGAGGG + Intronic
924557452 1:245130047-245130069 TGGCATGATGAGGGGGAAGTTGG + Intergenic
924700190 1:246443605-246443627 TGGTGTAGTGGCAGGGAAGATGG + Intronic
1062770618 10:97604-97626 TGGTGTCATGAGGGGGCAGGGGG + Intergenic
1062867281 10:866350-866372 TGGGTGGATGAGAGAGAAGAGGG - Intronic
1064193675 10:13228512-13228534 AGGTGGGGTGAGAGGGTAGAAGG + Intronic
1064347691 10:14547992-14548014 TGGTCTGAAGAGAGGGAAGTGGG - Intronic
1065846878 10:29751829-29751851 TAGGGTGATGAGAGGGAGAATGG + Intergenic
1065852763 10:29804666-29804688 TGCTCTGCTGAGAGGGAGGATGG - Intergenic
1065876222 10:29999731-29999753 TGATGTGATGTGAAGGAAGGAGG - Intergenic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1068873934 10:61977000-61977022 TGGGGTGAGGGGAGGGGAGAGGG - Intronic
1069292577 10:66799567-66799589 TGTGGTGAGGAGAGGGAAGAAGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069663077 10:70136745-70136767 TGGCTTGGTGAGAGAGAAGATGG - Intergenic
1069781612 10:70959708-70959730 GGGAGTGATGAGAAGGTAGAGGG - Intergenic
1070696978 10:78570803-78570825 TGGTGTGGTGAGAGGCAGGCAGG - Intergenic
1071099341 10:82017075-82017097 TGGGGTGGGGAGAGGGGAGAGGG - Intronic
1071948095 10:90671122-90671144 TAGTGTCATGAGAGGGATGTTGG + Intergenic
1074001057 10:109373243-109373265 TGTTGTGGGGTGAGGGAAGAGGG + Intergenic
1074293392 10:112158867-112158889 TGGTGGGATGGAAGGGATGAGGG - Intronic
1074398261 10:113118309-113118331 TGAGGTGATCAGTGGGAAGAGGG + Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075753186 10:124791117-124791139 TGGCGGGATGAGAGGGAGCAGGG - Intronic
1075984279 10:126770189-126770211 AGATGTGGGGAGAGGGAAGATGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076275569 10:129195808-129195830 TGTTGAGATGAGATGGTAGAGGG - Intergenic
1076708083 10:132313087-132313109 TGGTGGGATGGGAGGTCAGACGG + Intronic
1077278932 11:1733267-1733289 TGGTGGGATGGGAGGGCAGGAGG - Exonic
1077604195 11:3596478-3596500 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1077892362 11:6428578-6428600 TGGTGAGATGAGACTGGAGAGGG - Intergenic
1078851246 11:15165946-15165968 TGATGGGATGAGAGTGAAGTTGG + Intronic
1079614995 11:22481210-22481232 AGGTGTATTGAGAGAGAAGAGGG - Intergenic
1079617213 11:22510511-22510533 TGCTGAGCGGAGAGGGAAGAGGG - Intergenic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1079929794 11:26543599-26543621 TGGTGTGGCGGGAGGGAGGAGGG - Intronic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081387993 11:42495745-42495767 AGATGTGATGAGAGAGATGAAGG + Intergenic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082245756 11:49920305-49920327 TGGTTTGAAGAAAGGGAATATGG + Intergenic
1082629572 11:55526147-55526169 TGGGGTGGGGAGAGGGGAGAGGG - Intergenic
1083250543 11:61464008-61464030 AGGAGAGAGGAGAGGGAAGAGGG - Intronic
1083294696 11:61708941-61708963 TGGGGTGATGGGAGGGGATAGGG + Intronic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083729643 11:64645856-64645878 TGGTTTCAAGAGAGGAAAGAGGG - Intronic
1083951514 11:65959171-65959193 TGGCCTGAGGAGAGAGAAGACGG - Exonic
1084085565 11:66853530-66853552 TGGAGTGAGGAGAGGGCTGAGGG - Intronic
1084226645 11:67719290-67719312 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084260093 11:67971072-67971094 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084812679 11:71624182-71624204 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1086046607 11:82539979-82540001 TGATGTGATGGAAGGGAAGTTGG + Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086770012 11:90750426-90750448 TTGTGTGATGAAAGGTAAAAGGG - Intergenic
1087558595 11:99754224-99754246 TGGTAAGATGAGAGTAAAGATGG + Intronic
1087788658 11:102384340-102384362 TCCTGAGATGAGAAGGAAGAGGG + Intergenic
1087829679 11:102805869-102805891 GGGTAGGATGAGAGGGAAGTGGG - Intergenic
1089490774 11:118882489-118882511 AGGTGTGAAGAGGGGAAAGAGGG + Intergenic
1090430602 11:126642974-126642996 TGGATGGATGGGAGGGAAGAAGG - Intronic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091351106 11:134895255-134895277 GGGTGGGATGAGGGAGAAGAGGG - Intergenic
1091618266 12:2066479-2066501 TGGAGTCGTGAAAGGGAAGATGG + Intronic
1091768639 12:3137691-3137713 AGGTTTGCTGAGAGGGAAGGGGG + Intronic
1092030641 12:5280941-5280963 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092975974 12:13745296-13745318 TGGTGGGAAGAGAGAGCAGATGG + Intronic
1093173339 12:15882904-15882926 TGGTGTGGTGAGGGGGGAGGGGG + Intronic
1093857745 12:24126441-24126463 TGGTGTGAAGAGAGGAATAAGGG - Intergenic
1093902404 12:24651035-24651057 TGGGGTGGTGAGGGGGAAGTGGG - Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094069416 12:26396491-26396513 TGGTGTGAGGAGAAGCAGGAAGG - Intronic
1094179040 12:27571427-27571449 TGGTAAAATGAGAGGGAAAATGG + Intronic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1095218140 12:39574538-39574560 GGGTGAGATGAGAGGGAGAAAGG - Intronic
1096504631 12:52084965-52084987 TGGTTGGATGTGAGGGATGAGGG + Intergenic
1096507326 12:52102714-52102736 TGGTGAAACGAGAGGGAAGTAGG + Intergenic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1097061001 12:56283830-56283852 TGGTGGCATGAGAGGCATGAAGG - Exonic
1097268003 12:57756678-57756700 TGGGGGGATTAGAGGGGAGAAGG - Intronic
1097324483 12:58260333-58260355 TGGTGTGAGAAGAGGGCAAAGGG - Intergenic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1100189828 12:92178525-92178547 AGGTGTGATGGGAGGGGAGGTGG + Intergenic
1101530773 12:105571312-105571334 TGCTGTGATGAGGGAGAACAGGG + Intergenic
1101766774 12:107708243-107708265 TTTTGAGATGAGAGGGAAGCAGG - Intronic
1101986662 12:109452452-109452474 AGGTGTGATGAACAGGAAGAGGG + Intronic
1102031132 12:109740840-109740862 TGGTGTGATTAGAGCAGAGATGG + Intronic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1103364426 12:120370902-120370924 TGGGGTGGGGAGAGGGAAGGAGG - Intergenic
1104143309 12:126008766-126008788 TACTGTGATGGTAGGGAAGATGG - Intergenic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1105623487 13:22091024-22091046 TGGTAGGATGACAGGGAGGATGG + Intergenic
1105638125 13:22235919-22235941 TGGTTTGAGACGAGGGAAGAGGG - Intergenic
1106239304 13:27897312-27897334 TGGAGTGTTAAGAAGGAAGAAGG + Intergenic
1106407976 13:29490400-29490422 TGTTATAATGAGAGGGAAGAGGG - Intronic
1106876824 13:34083419-34083441 TTGGGGGATGAGAGAGAAGAAGG + Intergenic
1107169776 13:37327151-37327173 TAGTGAGATGAGATTGAAGAGGG + Intergenic
1107371492 13:39755028-39755050 TAGTGTGGTGAGAGGAAAAATGG + Intronic
1107460899 13:40601110-40601132 TAGTCTGATGAAAGGGAAGATGG - Intronic
1107546322 13:41436805-41436827 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1108052478 13:46460226-46460248 TGGGGTGGGGAGAGGGGAGAGGG - Intergenic
1108963067 13:56261397-56261419 TGGAGTGATGAGTGAGAAGGTGG - Intergenic
1109239558 13:59868722-59868744 GGTTCTGAGGAGAGGGAAGAAGG - Intronic
1109538793 13:63745876-63745898 TGGAGTGGGGAGAGGGGAGAGGG + Intergenic
1109545042 13:63833890-63833912 TGGAGTGGGGAGAGGGGAGAGGG - Intergenic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1111694280 13:91604093-91604115 TGGTGTGGTGGGAGGGGGGAGGG - Intronic
1113717849 13:112526350-112526372 TGGTGTGATGATAGTGATGATGG - Intronic
1113717917 13:112526809-112526831 TGGTGTGATGATGGGGATGATGG - Intronic
1114639144 14:24207410-24207432 TGGTGTCATCAAAGGGCAGATGG - Exonic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1115820723 14:37210101-37210123 TAGTGTGCTGTGAGAGAAGAGGG - Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1116274973 14:42821717-42821739 TGGTGACATGAAAGGCAAGATGG + Intergenic
1116367474 14:44085713-44085735 GGGAGGGATGAGAGGGAGGAAGG - Intergenic
1117484895 14:56186111-56186133 TCATGAGATGTGAGGGAAGAAGG + Intronic
1117648918 14:57882101-57882123 TGGGCTGATGAGAGGGAGGGAGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1120228597 14:81818500-81818522 TGGTGGGTGGAGAGAGAAGAAGG + Intergenic
1120312626 14:82850235-82850257 TGGGGTGAGTAGAGGAAAGAGGG + Intergenic
1120827496 14:88968986-88969008 TGGTGTGTTCAGAGTGCAGAGGG - Intergenic
1122996834 14:105269704-105269726 TGGGGTGATGACAGGCAGGACGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1125671999 15:41480467-41480489 GGGTATGGTGAGAGGGAACAGGG + Intronic
1126524019 15:49630185-49630207 TGGTGAGAGGAGAAGGAAGAAGG + Intronic
1127040669 15:54973161-54973183 TGGTGATAGGAGAGAGAAGAAGG + Intergenic
1127873331 15:63091144-63091166 GGGTGGGGTGAGAGGGAAGCCGG - Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128632157 15:69278610-69278632 AGCTGTGGTGAGAGGGAAGGGGG + Intergenic
1128699863 15:69796302-69796324 TTGTGAGAAGAGATGGAAGAAGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129677916 15:77642379-77642401 TGGTGTGGGGAGAGGGAGAAAGG + Intronic
1130096590 15:80860801-80860823 TGGTGAGGTCAGAGGGCAGAGGG - Intronic
1130658783 15:85813490-85813512 TGGTGGAAAGAGTGGGAAGAGGG - Intergenic
1130705811 15:86232048-86232070 TGGTGGGGTGAGAGAGAGGAAGG + Intronic
1131675294 15:94665095-94665117 TGGGGTGGTAACAGGGAAGACGG - Intergenic
1131958403 15:97762717-97762739 TCGTGGGATGAGAAGGAAGTCGG + Intergenic
1133392837 16:5423036-5423058 AGGAGTGGGGAGAGGGAAGAGGG + Intergenic
1133832130 16:9333022-9333044 TGGAGTGATGAGCGGAGAGAAGG - Intergenic
1134302215 16:13001848-13001870 TGGGTTGATGAGTGGGTAGAGGG + Intronic
1134582927 16:15386925-15386947 TGGTTTGGTGAGAGGGAATTAGG + Intergenic
1134586050 16:15412090-15412112 TGGTTTGATGAGAGGGAATTAGG + Intronic
1134813784 16:17189176-17189198 TGGTGTTGAGAGAAGGAAGAAGG + Intronic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1135314262 16:21430987-21431009 TGGTTTGGTGAGAGGGAATTAGG + Intronic
1135367185 16:21863265-21863287 TGGTTTGGTGAGAGGGAATTAGG + Intronic
1135444629 16:22507895-22507917 TGGTTTGGTGAGAGGGAATTAGG - Intronic
1135478054 16:22795236-22795258 TGGTGAGAGGAGAGGGTAGCAGG - Intergenic
1135644872 16:24152970-24152992 GGCTGTGATGAGAGAGAAGATGG + Intronic
1136193356 16:28632437-28632459 TGGTTTGGTGAGAGGGAATTAGG - Intergenic
1136310932 16:29409695-29409717 TGGTTTGGTGAGAGGGAATTAGG + Intergenic
1136324374 16:29511472-29511494 TGGTTTGGTGAGAGGGAATTAGG + Intergenic
1136439059 16:30251454-30251476 TGGTTTGGTGAGAGGGAATTAGG + Intronic
1136932336 16:34430646-34430668 TGGGGGGAAGAGAGGGAGGAAGG - Intergenic
1136972236 16:34981168-34981190 TGGGGGGAAGAGAGGGAGGAAGG + Intergenic
1137564415 16:49524459-49524481 TCCTGCGATGAGGGGGAAGATGG + Intronic
1138189047 16:54999403-54999425 TGGAGTGGGGAGAGGGCAGAAGG - Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138544438 16:57707297-57707319 TTGGGTGATGGGAGGGGAGATGG + Intronic
1139234078 16:65316223-65316245 TCGTGTGGTGATAGGCAAGAAGG + Intergenic
1139858607 16:70002072-70002094 TGGTTTGGTGAGAGGGAATTAGG + Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140438583 16:74969019-74969041 TGGTGTGCTGAGGGTGGAGAGGG - Intronic
1141152720 16:81575343-81575365 TGGTGTGGGGAGAGAGAGGAAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141695967 16:85619565-85619587 TGGTGTGATCTGTGGGCAGATGG + Intronic
1141728378 16:85805863-85805885 TGGTGAGTAGAGAGGGAGGAAGG + Exonic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143474045 17:7192893-7192915 TGGGGTGGGGAGAGGGGAGAAGG + Intronic
1144319791 17:14103638-14103660 GGGTGGGATGAGAGGGGAGGAGG - Intronic
1144627067 17:16849441-16849463 TGGTGCGATGAGATGGACGTGGG + Intergenic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1144879374 17:18423271-18423293 TGGTGCGATGAGATGGACGTGGG - Intergenic
1145152866 17:20521116-20521138 TGGTGCGATGAGATGGACGTGGG + Intergenic
1145353800 17:22117783-22117805 TGGGGTGCTGGGAGGGGAGAGGG - Intergenic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1146185125 17:30719724-30719746 GGATGTGATGTGAGGGGAGAGGG + Intergenic
1146447302 17:32942615-32942637 TGGAGTCAGGAGAGGGAAGCTGG + Exonic
1146501498 17:33368743-33368765 TGGTGAGGAGAGAGGAAAGATGG - Intronic
1146736152 17:35241067-35241089 TGGAAGGCTGAGAGGGAAGACGG - Intergenic
1146810579 17:35899822-35899844 TGTGGTGGTGAGAGAGAAGAGGG + Intergenic
1146958329 17:36950237-36950259 AGGTTTGATGAAGGGGAAGATGG + Exonic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1147630241 17:41925642-41925664 TGTTGTGTTGAGAAGGAAGTGGG + Intronic
1148477829 17:47940984-47941006 CGGTGAGGTGAGAAGGAAGATGG - Intergenic
1148905256 17:50907867-50907889 TGTGGTGATGGGTGGGAAGATGG - Intergenic
1149178086 17:53899485-53899507 TGGTGTGGTGATAGGGATGGTGG - Intergenic
1149307622 17:55364295-55364317 TGATGTCAAGAGAGGGCAGAAGG + Intergenic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150559563 17:66282863-66282885 TGATGGGATGAGAGGGAGGTGGG - Intergenic
1151327813 17:73389713-73389735 TGGGGAGGGGAGAGGGAAGATGG + Intronic
1151513291 17:74575611-74575633 TGTTGTGATGATAGGGAAGCGGG + Intergenic
1152145599 17:78566907-78566929 GGGTGTGATGGGAGGGCACACGG - Intronic
1152409507 17:80116100-80116122 TGGAGTGATGTCAGTGAAGATGG - Intergenic
1152506441 17:80752220-80752242 TGTTGTGGGGAGAGGGGAGAGGG - Intronic
1152708100 17:81855790-81855812 TGGGGAGTGGAGAGGGAAGAGGG + Intronic
1153447710 18:5192784-5192806 TGGTGGGGTGAGGGGGAAGGGGG + Intronic
1153526601 18:6000839-6000861 AGGAGTGATGTTAGGGAAGATGG + Intronic
1154098446 18:11444176-11444198 TGTTGTGGGGAGAGGGAAGGGGG - Intergenic
1154313517 18:13285367-13285389 AGGTGTCATGAGTGGGCAGAGGG + Intronic
1155281549 18:24245805-24245827 TGATGAGATGAGATGGAAGGAGG - Intronic
1155298701 18:24409134-24409156 TGGTTGAATGAGAGGGATGAGGG + Intergenic
1155539124 18:26848727-26848749 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156237849 18:35221331-35221353 TGGTGTCATGAGGGGGAACAGGG - Intergenic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1157947598 18:51998264-51998286 TTGGGTGCTGAGTGGGAAGAAGG + Intergenic
1158215451 18:55096324-55096346 TGGGGTGATCAGAGGGAGAAAGG + Intergenic
1158323070 18:56284649-56284671 TGGGGGGATCAGAGGGGAGAAGG - Intergenic
1158497522 18:57969983-57970005 TGGAGTGATGAAGGAGAAGAGGG - Intergenic
1158750876 18:60259130-60259152 TGGTGTGAGGACAGGGACAAAGG + Intergenic
1159907900 18:74114626-74114648 TGGATTTATGAGAGGAAAGAGGG - Intronic
1160266713 18:77344766-77344788 TGGTGTGATAGGAGGGAGGCTGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160410311 18:78671225-78671247 TGCTGTGATCAGAGAGAAGACGG - Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161151312 19:2711526-2711548 TGGAGGGAGGAGAGGGAAGGTGG - Intergenic
1161186431 19:2924449-2924471 TTGTATGATGGGAGGGAAGCTGG - Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161607249 19:5222018-5222040 TGGTGTGAAGTGAGGGATCAGGG - Intronic
1161934391 19:7362636-7362658 TGGTGAGGGGAGGGGGAAGATGG - Intronic
1162973655 19:14195965-14195987 GGATGTGATGTGAGGGGAGAGGG - Intronic
1163287454 19:16357523-16357545 TGGTGGCATGAGCGGGAAGCAGG + Intronic
1163562860 19:18030835-18030857 TGGTGGCATGAGAGGCATGAAGG + Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164592528 19:29514287-29514309 TGGGGGGATGAGGGGGAAGGAGG + Intergenic
1164860883 19:31561284-31561306 AGTAGTCATGAGAGGGAAGATGG - Intergenic
1165242271 19:34478276-34478298 TGGAGTGAGGAGATAGAAGATGG + Intergenic
1166187985 19:41154390-41154412 TGGTTTGGTGGGAGGGTAGAAGG + Intergenic
1166397938 19:42456163-42456185 TAGTGTGATGAGAAGGAAGCAGG - Intergenic
1166735136 19:45079485-45079507 TGGGGTGAGGAGAAGGGAGAAGG + Intronic
1167305755 19:48708435-48708457 TGTTGAGATCAGAGGAAAGAAGG + Intergenic
1168091616 19:54089215-54089237 TGCTGGGATTAGAGGAAAGAAGG + Intergenic
1168241133 19:55089415-55089437 TGGGGTGATGGGAGTGAAGATGG - Intergenic
1168348674 19:55663344-55663366 GGCTGTGATGACACGGAAGAGGG - Intronic
925073284 2:988026-988048 TGAGGTGATGAGGAGGAAGACGG - Intronic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925233387 2:2255721-2255743 GGGTGTGATGAGGATGAAGACGG - Intronic
925593934 2:5536832-5536854 AGGGTTGGTGAGAGGGAAGATGG - Intergenic
925645226 2:6029181-6029203 TTGTGTGATGAAAGGGGAAAGGG - Intergenic
926620611 2:15043658-15043680 TGGTGTGATTAAGGGGGAGAGGG - Intergenic
926836999 2:17034019-17034041 TATTGTGATGAAAGGGAATATGG - Intergenic
927102581 2:19799437-19799459 TGCTATGATGGAAGGGAAGAAGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927827551 2:26319121-26319143 AGATGGGATGGGAGGGAAGAGGG + Intronic
928220061 2:29396049-29396071 TGTTGTGATGAGTGAGGAGAGGG + Intronic
928286001 2:29990513-29990535 TGGGGAGATGAGAAGGAAGGAGG + Intergenic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
928402117 2:30986485-30986507 TGGGGTGATGGGATGGAAGTGGG + Intronic
928403522 2:30996558-30996580 TGGTGTGAATAGAGAGTAGAGGG - Intronic
928758400 2:34553489-34553511 TGGTGAAATGAAAGGGAAGAAGG - Intergenic
929682454 2:44005229-44005251 TGGTGTGTTCAGAGGGCATAGGG - Intergenic
929855243 2:45632101-45632123 TGGTCTGAAGAGCAGGAAGAGGG + Intergenic
930564671 2:53004397-53004419 TGTTGTGATGATGGTGAAGATGG + Intergenic
930864990 2:56113728-56113750 TAGTGTGGTGAGAGGGAAAGAGG - Intergenic
931769900 2:65488433-65488455 TGGTGTGAAAGGAAGGAAGATGG - Intergenic
932279337 2:70476211-70476233 TGGTTTGAAGAGATGAAAGAAGG - Intronic
932481558 2:72042426-72042448 TGGTGTGGTAAGAGGGATAAAGG + Intergenic
932517786 2:72370862-72370884 TGGGGTGATGGGAGGGGGGAGGG + Intronic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933721104 2:85398325-85398347 TGGGGTGATGAGAGGGAGTGGGG - Intronic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934520575 2:95017842-95017864 TGATGTGATCAGAGGGAGGATGG + Intergenic
934571255 2:95374667-95374689 AGGTGGGGTGAGAGGGAGGAGGG - Intronic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
936625135 2:114140736-114140758 TTGTGTGATGAAAAGGAATAGGG - Intergenic
937055689 2:118934411-118934433 AGGAGTGATGACAGGGAAAATGG - Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937332026 2:121037650-121037672 TGGTTGGATGGGAGGGAAGTTGG - Intergenic
940186203 2:150986778-150986800 TGGCGTGATGCTAGGGAGGAAGG - Intergenic
940420043 2:153470326-153470348 TGGTGAGAGGAGAGAGAACATGG - Intergenic
940628256 2:156204210-156204232 GGGTGTATTGAGAGAGAAGAGGG - Intergenic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
943068412 2:183113367-183113389 TGGTGGCAGGAGAGGGAAGTTGG + Intergenic
943394439 2:187315589-187315611 TGGTGGGGCGAGAGGGAACAGGG - Intergenic
943787449 2:191893976-191893998 TGGCATCATGAAAGGGAAGATGG + Intergenic
944825314 2:203477559-203477581 TCATATGAAGAGAGGGAAGAGGG - Intronic
944923914 2:204443342-204443364 TGGATGGATGGGAGGGAAGATGG + Intergenic
945556229 2:211279709-211279731 TGGTGGGATAAGGAGGAAGAGGG + Intergenic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946392677 2:219426055-219426077 TGGTGTCCTGGGATGGAAGAAGG - Exonic
946537949 2:220651739-220651761 TCCTATGCTGAGAGGGAAGAAGG + Intergenic
946927753 2:224642681-224642703 TGGTTTGAGGAGCAGGAAGAAGG + Intergenic
947665264 2:231901319-231901341 TGGTGAGATGGGAGGGTAGGAGG - Intergenic
948154535 2:235770814-235770836 TGGTGTGGTGAGCAGGAAGATGG + Intronic
948318033 2:237045158-237045180 TGGTGTGAAGAGAGCCAAGGTGG - Intergenic
948433882 2:237939085-237939107 TCATGTGATGACAGGAAAGAGGG - Intergenic
948648142 2:239421990-239422012 TGGGGTGTTGCGAGAGAAGAAGG - Intergenic
948969958 2:241417839-241417861 TTGTGTGTTTAGAGGGCAGATGG - Intronic
1169123565 20:3111525-3111547 TGGTGTGAAGAGAGGTGAGGAGG - Intronic
1169593516 20:7171943-7171965 TGAAGTGCAGAGAGGGAAGAAGG + Intergenic
1169731008 20:8785580-8785602 GGGTGTGATGGGAGCCAAGAGGG + Intronic
1170735106 20:19007557-19007579 AGCTGTGATGAGAAGAAAGAGGG + Intergenic
1170740389 20:19050896-19050918 TGGTGTGATTAGAGAGAAGGGGG - Intergenic
1171232739 20:23500506-23500528 TGGTGGAATGGGAGGCAAGAGGG + Intergenic
1171324227 20:24276653-24276675 AGGTGTGCTTAGAGGCAAGAGGG + Intergenic
1171564058 20:26161924-26161946 TGGAGTGGTGGGAGGGGAGAGGG - Intergenic
1172007433 20:31827014-31827036 TGGAGGGATGGGAGGGCAGAGGG - Intronic
1172116245 20:32575081-32575103 TTCTGTGGTGAGAGGCAAGAGGG - Intronic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1172763857 20:37340528-37340550 TGGCCTGATGGGAGGGCAGAGGG - Intergenic
1173006331 20:39142444-39142466 TGGTGTGGTGAGGGGGAGGGAGG + Intergenic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174402295 20:50282587-50282609 TGCTAGCATGAGAGGGAAGAAGG + Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175168584 20:57063619-57063641 TGGGGTGATGAGAGTGGACAGGG + Intergenic
1175456928 20:59122519-59122541 TGAGGTCCTGAGAGGGAAGAGGG + Intergenic
1175563849 20:59956549-59956571 TGGGGGGAAGAGTGGGAAGAGGG - Intergenic
1176729584 21:10480001-10480023 TGGTGTGGTAAGAGAGATGATGG + Intergenic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177170211 21:17647048-17647070 TGTTGTCATGAGAGGTGAGAAGG - Intergenic
1178443354 21:32616503-32616525 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1179910354 21:44444136-44444158 TGGGGTGCGGAGAGGGCAGAGGG + Intergenic
1180669127 22:17539507-17539529 TGTTGTGAGGTGGGGGAAGAGGG + Intronic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1182157621 22:28089964-28089986 TGGGGTGGTGGGAGGGGAGAAGG + Intronic
1182889195 22:33802660-33802682 TGGTGGGTTGAGTGGGGAGAGGG - Intronic
1183786097 22:40030000-40030022 TGGTGGAATAAAAGGGAAGAGGG + Exonic
1183927979 22:41219442-41219464 GGATGTGATGAAAGGGATGAAGG + Exonic
1183950072 22:41347832-41347854 TGGTGGGATCAGAGGGAGGGAGG + Intronic
1183958936 22:41399260-41399282 TGATGTGGTGGGAGGGAAGCCGG + Exonic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184356671 22:43985352-43985374 TGGTCTGGTGGGAGGGATGAAGG - Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
949981109 3:9502140-9502162 TGGAGTGACGAGAGGGCAGAAGG + Exonic
950105653 3:10386684-10386706 TGATGGGATGGGAGGGCAGAGGG + Intronic
950520153 3:13493308-13493330 TGAGGGGAGGAGAGGGAAGAGGG - Intronic
950762756 3:15248025-15248047 TGGGGTGAGGGGAGGGGAGAGGG + Intronic
950809957 3:15641643-15641665 TGGGGTCATGTGAGGGAAGGAGG - Intronic
951525975 3:23653162-23653184 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
952755200 3:36859553-36859575 TGGAGAGATGTCAGGGAAGATGG - Intronic
953355578 3:42253764-42253786 TGGAGTGAAGTGAGTGAAGAGGG + Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953412072 3:42696303-42696325 TGGTGTGAGAAGAGGAGAGACGG - Intronic
954407803 3:50355242-50355264 TGCTCTGAGGAGAGGGAAGAAGG - Exonic
954549351 3:51467499-51467521 TGGGGTGGGGAGAGGGGAGAGGG + Intronic
954799527 3:53179135-53179157 AGTTGTGATGAGACTGAAGAGGG - Intronic
955080895 3:55657028-55657050 GGGGGAGATGAGAGGGAAGGTGG - Intronic
955213233 3:56961686-56961708 TGGTGGGATGAGAGGAAGGTGGG - Intronic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
955699477 3:61669821-61669843 TGATGTGGTGACAGGGAGGAGGG + Intronic
955977245 3:64490494-64490516 TGGGGGGAAGAGAGAGAAGAAGG + Intergenic
956505507 3:69934242-69934264 TGGTGAAATGAGAGTGAAAAAGG - Intronic
956830865 3:73046503-73046525 TGGTGAAATGTGAGGAAAGAGGG + Intronic
959749304 3:109814310-109814332 TGGTGAAGTTAGAGGGAAGATGG + Intergenic
959796347 3:110433171-110433193 TGGTGTGAGGTGAGGTCAGAGGG + Intergenic
960909779 3:122637940-122637962 TGGGGTGGGGAGAGGGGAGAGGG - Intronic
960974368 3:123160564-123160586 TGATGTGATGTGAGGGATGAGGG - Intronic
961057968 3:123804847-123804869 TGATTGGAGGAGAGGGAAGAAGG + Intronic
961276154 3:125728657-125728679 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
961875335 3:130018383-130018405 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
961931337 3:130536698-130536720 TGGAGTGGTGAGAGAGAGGAAGG + Intergenic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203460 3:133417397-133417419 TGGGGTGAGTAGAGGGGAGATGG - Intronic
962326657 3:134440246-134440268 TGGTGTGGTGTGAGAGCAGAGGG - Intergenic
962418495 3:135205745-135205767 TGGTGTGATGGATGGGCAGAGGG - Intronic
962476752 3:135761730-135761752 TGGTGTGATAAATGGGAAGCAGG - Intergenic
962487170 3:135855470-135855492 TGGGGTGGGGAGAGGGGAGAGGG - Intergenic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
963060706 3:141222492-141222514 AGGTATGATGGGAGGGAGGAAGG + Intergenic
963156290 3:142100675-142100697 AGGTGTGAAGAAAGGGAAGGAGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
964531790 3:157676121-157676143 TGGTGTGGGGAGAAGGGAGATGG - Intronic
964587572 3:158324373-158324395 TGGGGTGAGGGGAGGGCAGAGGG - Intronic
964782000 3:160349923-160349945 TAGTGTGATGAAAGATAAGAAGG - Intronic
966468209 3:180256232-180256254 TGAGGTGAGGAGAGGGAAGAGGG + Intergenic
967276925 3:187784865-187784887 TGGGGTGAGGAGAAGGGAGATGG + Intergenic
967482747 3:189992640-189992662 TGATGTGATTAGAGTGAAGCTGG - Intronic
967493258 3:190117280-190117302 TGGTGTGTTGGAGGGGAAGAAGG - Intronic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
969284941 4:6197260-6197282 TGGTGGGCTGAGAGGTATGAGGG - Intronic
969520713 4:7676275-7676297 AGGTGGGGTGAGAGGGCAGAGGG - Intronic
969735349 4:8985569-8985591 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969786654 4:9463400-9463422 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
970279057 4:14433990-14434012 TGGGGTGATGAGACAAAAGAGGG - Intergenic
970512597 4:16795938-16795960 TGGGGTACTGAGAGGGAAGGAGG + Intronic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
971898649 4:32628866-32628888 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
971987040 4:33839334-33839356 TGGGGTGGTGGAAGGGAAGAGGG + Intergenic
973562175 4:52148354-52148376 AGGAGAGAAGAGAGGGAAGATGG + Intergenic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974178100 4:58350060-58350082 TGGTCTGATGAAAGGAAAAATGG - Intergenic
974283572 4:59833239-59833261 TGAAGTGGTGAGAGTGAAGAAGG - Intergenic
974536197 4:63178975-63178997 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
974750479 4:66134009-66134031 TGTTGTGAGGTGGGGGAAGAGGG + Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975358164 4:73432706-73432728 TGGGGAGATGAGAGTGAAAAGGG + Intronic
975812805 4:78187248-78187270 TGGAGTGATGAAAGGGGAGAGGG + Intronic
975830806 4:78366626-78366648 TGATGTGCTGAAAGGGCAGAGGG - Intronic
975936077 4:79582512-79582534 TGGTGTGAAGAGGAGGAGGATGG + Intergenic
975936648 4:79589302-79589324 TGGTGTGACGAGGAGGATGATGG + Intergenic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
978808500 4:112825188-112825210 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
979291838 4:118986791-118986813 TGGTGAAATGAGATGGAAAAAGG - Intronic
979362855 4:119784637-119784659 TGGTGACAGGAGAGGGAAGCAGG + Intergenic
980216608 4:129859769-129859791 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
980395334 4:132206989-132207011 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
980430421 4:132686739-132686761 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981262541 4:142738454-142738476 TGTTGTGGTGTGGGGGAAGAGGG + Intronic
981337401 4:143582279-143582301 TAGAGTGCTGAGAGGGAACATGG + Intronic
981634557 4:146862026-146862048 AGCTGTGAAGAGAGGTAAGAAGG - Intronic
981713191 4:147728957-147728979 TGGGCTGAAGAGAGGGATGAGGG - Intergenic
981931404 4:150192756-150192778 AGTTGTTAGGAGAGGGAAGAAGG + Intronic
982426425 4:155267369-155267391 TGGGGTGCTGCCAGGGAAGATGG + Intergenic
983418727 4:167490655-167490677 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
983534156 4:168839564-168839586 TGGTGGGATGGGAGGGGTGAGGG + Intronic
984151495 4:176138557-176138579 TTTGGTGATGGGAGGGAAGATGG - Intronic
984710110 4:182877809-182877831 TGGTGGGATGAGGGGGCAGCTGG - Intergenic
985125891 4:186693949-186693971 TGTTGTGAAGAGTGGGGAGATGG - Intronic
985932132 5:3067027-3067049 TGGTTTGTTAGGAGGGAAGATGG + Intergenic
986701118 5:10409659-10409681 TGCTGTGATGAGAGGAAACTGGG + Intronic
987078069 5:14402929-14402951 TGGTGTGGTGAGAGCGTAGATGG + Intronic
987309361 5:16667584-16667606 TCGTGCAGTGAGAGGGAAGAGGG - Intronic
987561029 5:19520172-19520194 TAGGGTGGTGAGAGTGAAGATGG - Intronic
988004564 5:25392274-25392296 TGGTGTCATGAAATCGAAGAAGG - Intergenic
988092351 5:26560289-26560311 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
989339456 5:40356767-40356789 TTGGGTGATGAGGGGGAAGAAGG - Intergenic
990137343 5:52662347-52662369 TGGTGTTATGTGAAGGAAGTGGG - Intergenic
990159696 5:52924047-52924069 TGGAGTGAGGGGAGAGAAGAGGG + Intronic
990307845 5:54510612-54510634 TTGTTTGATGAAAGGAAAGAGGG + Intergenic
990512509 5:56501433-56501455 TGGTGTGATTGGAGGGAATCTGG - Intergenic
990943871 5:61230152-61230174 GGGTGAGAGGAGAGGGGAGAGGG - Intergenic
991466108 5:66914314-66914336 GGGTGTGCTGATAGAGAAGAAGG + Intronic
992409944 5:76495521-76495543 TCCTGTGAGGAGAGGGATGATGG - Intronic
993174442 5:84465656-84465678 TGGTGTGAAGAGAGAGAGAAAGG + Intergenic
993465548 5:88241760-88241782 AGATGTGAAGAGAGGAAAGAAGG - Intronic
994943762 5:106359072-106359094 AGGTGAGATGAGCGGGAAGAGGG + Intergenic
995050356 5:107696488-107696510 TGGAGAGAGAAGAGGGAAGAAGG + Intergenic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
995644007 5:114291330-114291352 TGGGGTGAGGAGAGGGGGGAGGG - Intergenic
996136390 5:119847572-119847594 TGGGGTGAGGGGAGGGGAGAGGG - Intergenic
996460941 5:123742352-123742374 TGGGATAATGAGATGGAAGAGGG + Intergenic
997531185 5:134582143-134582165 TCATGTGATGAGGGGGAAGGAGG - Exonic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
997745983 5:136300799-136300821 TGGTGTGTTCAGTGGGAAGCTGG - Intronic
997759891 5:136434798-136434820 TGGTGTTAGGAGAGGGATGTCGG - Intergenic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998425094 5:142019626-142019648 TTTTGAGATGAGAGAGAAGAAGG - Intergenic
998702810 5:144723676-144723698 TGGTGAGAAGAGAGGGAAATGGG - Intergenic
999241133 5:150128058-150128080 ATGTGTGATGAGCGGGAGGAGGG - Intronic
999401139 5:151265122-151265144 AGGTTTGATGAGAGAGAGGAGGG + Intronic
999495259 5:152090493-152090515 TGTGGTGGTGGGAGGGAAGAGGG + Intergenic
999961726 5:156763150-156763172 TTGTGTAATGAGAGTGAAGTAGG + Intronic
1000047963 5:157536947-157536969 TGGTGAGATGGGGGTGAAGAAGG - Intronic
1000523537 5:162327736-162327758 TGGTGTGATCACAGAGAGGAAGG + Intergenic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1001675622 5:173512306-173512328 TGGCCTGATGAGTGGGAAAACGG - Intergenic
1002625604 5:180526332-180526354 TAATGTGATGAGAGGAAGGAAGG + Intronic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1003223908 6:4187889-4187911 TGGTGTCATGAGAGAGAAGAAGG + Intergenic
1003258027 6:4490793-4490815 AGTTGTGAAGAAAGGGAAGAAGG + Intergenic
1004088143 6:12471824-12471846 TGGTTTGATGAAAGAGAAGCAGG + Intergenic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1005912555 6:30323993-30324015 TGATGAGATGGGAGGGATGAAGG - Intergenic
1006110613 6:31742671-31742693 TGGGATGGTGAGAGGGAAGTGGG - Intronic
1006837760 6:37009177-37009199 TGGTGTGATCAGAGGTCAGCTGG + Intronic
1007019336 6:38503657-38503679 TGGTGGGATGAGTGTGAAGTTGG - Intronic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1008699782 6:54085174-54085196 TGGTGTCAGGAGAGAGGAGAAGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009727253 6:67551379-67551401 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
1010833335 6:80556961-80556983 TGGTGGCCTGAGAGGCAAGAAGG - Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011357984 6:86492260-86492282 TGGGGTGGGGAGAGGGAAGAGGG - Intergenic
1011855718 6:91688384-91688406 AGGTATGAAGAGAGGGAAGGAGG - Intergenic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013771585 6:113633662-113633684 TGCATTGATTAGAGGGAAGAGGG + Intergenic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1015010969 6:128347224-128347246 TGATGGGATCAGAGGGAACAAGG + Intronic
1015825873 6:137311210-137311232 TGGGATGCTGAGAGGGAGGATGG + Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016591876 6:145754941-145754963 TGGTGTTTTTAGAGGCAAGATGG + Intergenic
1016892674 6:149022264-149022286 TGTTGTCCTGAGATGGAAGAAGG + Intronic
1018007085 6:159632291-159632313 TGATGTGATCAGAGGGAGGACGG - Intergenic
1018038830 6:159904136-159904158 TGGGGAGATGAGGAGGAAGAAGG - Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018244675 6:161811547-161811569 TGGTGTGATGTAAGGGACAATGG - Intronic
1018379209 6:163242219-163242241 TGCTGTGAGGAGACGGAAAATGG - Intronic
1018604292 6:165580696-165580718 TGGTGTAATGAGAAAGAAGATGG + Intronic
1019069527 6:169332109-169332131 TGCCGTGAAAAGAGGGAAGAGGG - Intergenic
1019079158 6:169417828-169417850 TGGGGTGTGGTGAGGGAAGAGGG - Intergenic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1019490267 7:1309831-1309853 TGATGTGATGACAGTGATGATGG + Intergenic
1019805079 7:3117685-3117707 GGGGGAGAAGAGAGGGAAGAAGG + Intergenic
1020310437 7:6863496-6863518 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1020548911 7:9573096-9573118 TGGGGTGGGGAGAGGGCAGAAGG - Intergenic
1021382453 7:19984196-19984218 TGAGGAGAGGAGAGGGAAGAGGG - Intergenic
1022130949 7:27403911-27403933 TGGTGGGGTGGGAGGGAAGGTGG + Intergenic
1022360571 7:29652839-29652861 TGGTGTGATGAAAGATGAGAGGG + Intergenic
1022625269 7:32029571-32029593 GGGTGGGAGGAGAGGAAAGAAGG + Intronic
1022836980 7:34127492-34127514 TGGTGGGATCAGGGAGAAGAGGG - Intronic
1023056008 7:36290639-36290661 TGGTGAGGTCTGAGGGAAGAAGG - Intronic
1023447919 7:40251222-40251244 GGAAGTGAAGAGAGGGAAGATGG - Intronic
1023569966 7:41561624-41561646 TGGTGGGAAGAGAGAGAGGAAGG + Intergenic
1023765565 7:43507373-43507395 TGGTCTGAAGCGGGGGAAGAAGG + Intronic
1023867609 7:44245679-44245701 TGCAGAGATGAGAGGGAACAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1024172168 7:46800846-46800868 TGATCTGATAAGAGGGAAGATGG - Intergenic
1024608884 7:51046144-51046166 TGCTGGGAGGAGAGGGAACATGG + Intronic
1025152906 7:56574428-56574450 TGGTGTGCGAAGGGGGAAGAGGG - Intergenic
1025273669 7:57552285-57552307 TGGGGTGGTGGGAGGGGAGAGGG + Intergenic
1026412254 7:70135833-70135855 TGGTGTGAAGAGATGCCAGATGG - Intronic
1026450216 7:70522446-70522468 AGGAGTGGAGAGAGGGAAGAAGG - Intronic
1026567551 7:71501919-71501941 TAGTGAAATGGGAGGGAAGAAGG - Intronic
1026578740 7:71596531-71596553 TAGTGAAATGGGAGGGAAGAAGG + Intronic
1028202770 7:87981533-87981555 TGGTGTGGGGATAGGGAAGAGGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028853006 7:95557738-95557760 TGCTGTGATGAGAGGTATGGAGG + Intergenic
1029077140 7:97943825-97943847 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1030979841 7:116173599-116173621 GAGGGTGTTGAGAGGGAAGATGG - Intergenic
1031081438 7:117261172-117261194 TGGTGTAGGGAAAGGGAAGAAGG + Intergenic
1031330086 7:120453340-120453362 TGGAGTGAGGAGAGGGGACAGGG - Intronic
1031375284 7:121017126-121017148 TGCTTTGATGAGAAGAAAGAAGG + Intronic
1032155173 7:129462130-129462152 TGGTTTGAGGAGAGAGAAGATGG + Intronic
1032789083 7:135229137-135229159 TGGTGTGATGAGGAGAGAGATGG - Intergenic
1033025319 7:137766633-137766655 GGGTGTGCTGAGTGGGAAGGAGG - Intronic
1034002399 7:147430166-147430188 TGGTGAGTTGAGAGGGAAAATGG - Intronic
1034009609 7:147514904-147514926 TGCTGTGATGAGAGTGAATAGGG - Intronic
1034600000 7:152241571-152241593 TGGTGTGGTAAGAGAGATGATGG - Intronic
1035048025 7:155981800-155981822 TGGTTGGATGAGTGGGTAGATGG - Intergenic
1035056125 7:156038072-156038094 TGCTGTCATGAGAGTCAAGAAGG - Intergenic
1035323340 7:158048770-158048792 TGGTGGGATGATAGTGATGATGG - Intronic
1035323375 7:158049052-158049074 TGGTGGGATGATAGTGATGATGG - Intronic
1035587621 8:787850-787872 TGCTGTGAGGTGAGGGATGAGGG + Intergenic
1035754596 8:2022122-2022144 AGGTGGGCTGAGAGGGAGGAAGG + Intergenic
1035923076 8:3699826-3699848 TGGTGTGTCGTGTGGGAAGAGGG - Intronic
1036240645 8:7078121-7078143 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036261410 8:7243457-7243479 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036305189 8:7596099-7596121 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036313450 8:7702001-7702023 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036356039 8:8044095-8044117 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036461225 8:8954572-8954594 TGGGGTGATGAGATACAAGAGGG - Intergenic
1036795660 8:11754678-11754700 TGGGGTGAGGAGTGGGAAGGAGG - Intronic
1036819134 8:11925370-11925392 TGGTGAGACGAGAGGGAAGTAGG - Intergenic
1037429341 8:18793172-18793194 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
1037446421 8:18970575-18970597 TGCTGTTAAGAGAAGGAAGATGG - Intronic
1037627634 8:20621878-20621900 TGGTGTGATGTCAGGGGATATGG - Intergenic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1038911796 8:31973055-31973077 TGGTGTGGAGAATGGGAAGAGGG - Intronic
1039858375 8:41435663-41435685 TGGTGTGAAAAGAGAGAAAAAGG - Intergenic
1040074965 8:43220061-43220083 TGGTGTGAAGACAGAGGAGAGGG + Intergenic
1040312649 8:46244667-46244689 GGGTGTGGTGAGCGGGAAGCAGG + Intergenic
1040321672 8:46312132-46312154 TGGGGTGGGGAGAGGGGAGAGGG + Intergenic
1040949164 8:52918781-52918803 TGGTGTGAAGTCAGTGAAGAGGG + Intergenic
1041026396 8:53691045-53691067 TGAGGTGCTGAGAGGGAAAAAGG + Intergenic
1041056147 8:53988580-53988602 TGGTATAAGGAGAGGGATGAAGG + Intronic
1041128520 8:54669874-54669896 TGGTGGGGTGGGAGGGAAGGGGG + Intergenic
1041415082 8:57599080-57599102 AGGTGTGGTGAGAGGCAAGGTGG - Intergenic
1041441490 8:57901673-57901695 TGGTGTTTTAAGAGAGAAGAGGG - Intergenic
1042262366 8:66872363-66872385 TGGTGGGGTCATAGGGAAGAAGG - Intronic
1042435893 8:68764170-68764192 GGGTGTGAGGAGAGGGGACAGGG + Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043000012 8:74746692-74746714 TGGAGAGAAGAGAGAGAAGATGG + Intronic
1043403611 8:79908333-79908355 TGGAGAGATGATAGGGAGGAAGG + Intergenic
1043701458 8:83293241-83293263 TGGTGTGACGATAAGGGAGAGGG - Intergenic
1045357930 8:101405766-101405788 GAGGGAGATGAGAGGGAAGAGGG - Intergenic
1045585609 8:103532198-103532220 TGGTGTAATAAGTGGGAAGTAGG - Intronic
1045844427 8:106616991-106617013 AAATGTGATGACAGGGAAGAAGG + Intronic
1046610339 8:116416300-116416322 TGGGGTGGGGAGAGGGGAGAGGG + Intergenic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1046795310 8:118365154-118365176 TGGTCAGAAGGGAGGGAAGATGG - Intronic
1047884635 8:129235718-129235740 TGGAGTCTTGAGAGGGAAAAGGG - Intergenic
1047919571 8:129620253-129620275 TACTGTAATGAGAGGGAGGATGG - Intergenic
1048148183 8:131866004-131866026 GGGTGTGAGGAAAGAGAAGATGG - Intergenic
1048173189 8:132128163-132128185 TGGTGTGGTGAGGGGAAACAAGG + Exonic
1048269026 8:133013380-133013402 TGATTTGATGAAAGGGTAGATGG + Intronic
1048850050 8:138636377-138636399 TGAGATGATGGGAGGGAAGAAGG + Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048979320 8:139694655-139694677 TGGTGTGACAAGAGGGATGCTGG - Intronic
1050132467 9:2426991-2427013 GGGTGTAATGAGAAGGATGACGG + Intergenic
1050997554 9:12239234-12239256 TGGGGTGGGGAGAGGGGAGAGGG + Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051181130 9:14412989-14413011 AGGTGTGATTTGAGGGAAGGAGG - Intergenic
1051381441 9:16463016-16463038 TGGAGTAATGTGAGGAAAGAAGG - Intronic
1051783868 9:20721251-20721273 TGGTGAGAGGTGAGGGAAGGGGG - Intronic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052794191 9:32907938-32907960 GGGTATGATGAGAGGGTAGGAGG + Intergenic
1052813699 9:33083550-33083572 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
1053182106 9:35981576-35981598 TGGTAGGAAGAGAGGGAAGGAGG - Intergenic
1053448844 9:38175956-38175978 TGGGGCAAAGAGAGGGAAGATGG - Intergenic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1055370150 9:75589690-75589712 TTCTGTGATGATAGTGAAGAGGG + Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055835104 9:80430782-80430804 TGCTGTGATGAGTGGGCAAATGG + Intergenic
1055839935 9:80491409-80491431 TTCTGTGATGGGAGGGAAGTGGG - Intergenic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057528123 9:95820328-95820350 TGACGTGAGGAGAGGGAGGACGG + Intergenic
1058621262 9:106885863-106885885 TTATGTGATGACAGGGAATAGGG - Intronic
1058893247 9:109379270-109379292 TGTGGTGATGTTAGGGAAGAAGG + Exonic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059341620 9:113600670-113600692 TGGTGGGTGGAGAGGCAAGAGGG + Intergenic
1059648138 9:116287448-116287470 TGGGGAGGTGAGAGGGAACATGG + Intronic
1060044762 9:120331151-120331173 TGTTGTGTTGGGAGGGAAGATGG - Intergenic
1060116675 9:120946946-120946968 AGGTGTGACGGGAGGAAAGAAGG - Intergenic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1061480561 9:130895953-130895975 TAGTCTGATGAGAGGGCAGGCGG + Intergenic
1061845134 9:133383631-133383653 TGGTGTGATGATGGTGATGATGG + Intronic
1062721043 9:138044208-138044230 AGGTGTGATGGGAAGGCAGATGG - Intronic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1203584686 Un_KI270746v1:54074-54096 TGGTGTGGTAAGAGAGATGATGG - Intergenic
1203625359 Un_KI270750v1:12926-12948 TGGGGTGGTGGGAGGGGAGAGGG + Intergenic
1186627731 X:11312864-11312886 TGGAGTGATGAAAGTAAAGATGG - Intronic
1187039172 X:15575200-15575222 TGTTGTGATGGGAGGGTACAGGG - Intronic
1187570499 X:20496162-20496184 AGGGGTGAAGAGAGGGAAGTGGG - Intergenic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1188046306 X:25429025-25429047 TGAGGAGAAGAGAGGGAAGAGGG - Intergenic
1188335446 X:28926746-28926768 AGGTTTGAAGAGAGAGAAGAAGG - Intronic
1188433135 X:30129561-30129583 TGGGGGGAAGAGGGGGAAGAGGG + Intergenic
1188515969 X:30986251-30986273 TGGTGTAATAAGAGAAAAGAAGG + Intergenic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1189938872 X:46099801-46099823 GGGTCTGATTAGAGGGTAGAGGG - Intergenic
1190136965 X:47806641-47806663 TGATCTGGAGAGAGGGAAGAGGG - Intergenic
1191745894 X:64486053-64486075 TGGGGTGAGGGGAGGGAAGAGGG + Intergenic
1192065843 X:67884093-67884115 TGTTGTGAGGTCAGGGAAGAGGG - Intergenic
1192138942 X:68631141-68631163 AGGTCTGTTGAGAGGGTAGACGG - Intergenic
1192537008 X:71936708-71936730 TGCTGTGGTGAGAGTGATGATGG + Intergenic
1193787645 X:85779207-85779229 TGGTGTAATGACAGAGCAGAGGG + Intergenic
1195655462 X:107327733-107327755 TGCAGTGTTCAGAGGGAAGAAGG + Intergenic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1196276818 X:113775934-113775956 TGGTGAAATGAGACTGAAGATGG + Intergenic
1196324602 X:114388717-114388739 TGGTGTGGTGGGAGGGGAGGTGG - Intergenic
1197315728 X:124963656-124963678 TCTTCTGATGAGAGTGAAGATGG - Exonic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1198306296 X:135386937-135386959 TGGGGTGGTGGGAGGGAGGAGGG - Intergenic
1198329992 X:135613544-135613566 TGGTGTCATGAAAGGGAGAAGGG + Intergenic
1199675598 X:150186611-150186633 TGGAATGGTGAAAGGGAAGAGGG + Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1200015966 X:153164115-153164137 TGGTGGGAAGAGAGGAAGGAGGG - Intergenic
1200204116 X:154303634-154303656 TGGCATGATGAGGGGGAAGTTGG - Intronic
1201254590 Y:12094210-12094232 TGGTGTGGGGAGAGGGGGGAGGG + Intergenic