ID: 1118334981

View in Genome Browser
Species Human (GRCh38)
Location 14:64845587-64845609
Sequence CTGTAGAGATGAAAAGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 414}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118334980_1118334981 -10 Left 1118334980 14:64845574-64845596 CCAGACTATAGGACTGTAGAGAT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG 0: 1
1: 0
2: 2
3: 31
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118334981 Original CRISPR CTGTAGAGATGAAAAGCAAA AGG Intronic
901870769 1:12138136-12138158 CTGTAGAGATGAAAAAAAAAAGG + Intronic
902728799 1:18354947-18354969 TTTTTGAGATGAGAAGCAAATGG - Intronic
904263697 1:29305653-29305675 CTTTAGAGAAGCAAAGCAAAGGG + Intronic
905922019 1:41726155-41726177 CTTGAGACATGAAAAGAAAAAGG - Intronic
906025992 1:42674392-42674414 AGGAAGATATGAAAAGCAAATGG + Intronic
906580082 1:46929031-46929053 CTCTGGAGCTGAAAAGCCAAGGG + Intergenic
906603642 1:47149855-47149877 CTCTGGAGCTGAAAAGCCAAGGG - Intergenic
906780320 1:48567570-48567592 CTGTCGAGACAAAAAGCAATGGG - Intronic
907805868 1:57819313-57819335 TTTTAGAAATGAATAGCAAAAGG - Intronic
908481921 1:64549046-64549068 CTTTAAAGATGAAAAACTAAGGG - Intronic
908575660 1:65456672-65456694 CAGTATAGATTAAAAACAAATGG - Intronic
910436028 1:87207164-87207186 TTGAGGAGATGAAAAGCAACTGG - Intergenic
910463387 1:87471401-87471423 CAGAAGAGATGAAAGGGAAAGGG + Intergenic
910874351 1:91864280-91864302 CTGTGGAAAAGAAAGGCAAATGG + Intronic
911437091 1:97875042-97875064 ATGCAGAAATGAAAATCAAATGG + Intronic
911718416 1:101162445-101162467 CTTTGGAAATGAAAAGCAACAGG + Intergenic
914388709 1:147198401-147198423 CTATAGAAATAAAAAGTAAAAGG + Intronic
915369822 1:155339369-155339391 CTGCAGAGAAGAAAAGGAAGAGG + Intronic
915820560 1:159018988-159019010 CAGTAGAGATAATAATCAAAGGG - Intronic
917160810 1:172055143-172055165 GTTTAGAGATGAAAAGCAGGGGG - Intronic
920449615 1:206049598-206049620 CTGTAAGGATGAATAGAAAAAGG - Intronic
922218826 1:223542450-223542472 CTTTAGAGAAGAAAAGAAAGTGG + Intronic
923100704 1:230814196-230814218 TTCTAGAGATGAAAACCACAAGG - Intergenic
923434929 1:233959050-233959072 CTCTAGCGATGAAAGGGAAATGG - Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
1063037557 10:2302057-2302079 CTGCACAGAAGGAAAGCAAAGGG + Intergenic
1063849373 10:10167491-10167513 CTATAGAGATAAAATGAAAAGGG - Intergenic
1064281562 10:13955980-13956002 CTGTAGAGATGAATTTGAAAGGG - Intronic
1065641727 10:27789368-27789390 CTTTAGTGATAAAAAGCAGATGG - Intergenic
1065902318 10:30219805-30219827 CTGGAGAGAGAACAAGCAAATGG + Intergenic
1065909269 10:30287252-30287274 CTGTAGAGAGGAGAAGCAGCTGG - Intergenic
1066711829 10:38244476-38244498 ATGAGGAGATGATAAGCAAAGGG + Intergenic
1067076164 10:43184546-43184568 TTGTGGAGAGAAAAAGCAAATGG + Exonic
1067254406 10:44621695-44621717 ATATATAGATTAAAAGCAAATGG + Intergenic
1069142424 10:64842494-64842516 ATGGAGAGAAAAAAAGCAAAAGG - Intergenic
1069941432 10:71958578-71958600 ATGTAGAAAAGAAAATCAAAAGG + Intergenic
1070367147 10:75748556-75748578 TTGTAGAAATGAGAAGCACAGGG - Intronic
1071249960 10:83807515-83807537 CTGCAGCATTGAAAAGCAAATGG + Intergenic
1071273405 10:84029827-84029849 CTGTAAAGCGGAAAAACAAAGGG - Intergenic
1071782732 10:88864480-88864502 GTGTAGAAATTAAAAGCACATGG + Intergenic
1071845198 10:89514780-89514802 TTGTAGAGATGAAAAGGAGCGGG + Intronic
1072446699 10:95504958-95504980 GTGAGGAGATGAAAAGTAAAAGG + Intronic
1072763788 10:98080058-98080080 ATGTAGAGATGAATAGGAGAGGG + Intergenic
1073146777 10:101286245-101286267 CTGGAGAGAAGAAAAGGAATTGG + Intergenic
1074176176 10:111005653-111005675 CTGTAGAGTGGGTAAGCAAAAGG - Intronic
1075803670 10:125169840-125169862 CTGCAGAGCTGAAGAGCACAGGG - Intergenic
1078889422 11:15540657-15540679 CAGGAAAGATGAAAGGCAAAGGG - Intergenic
1079516027 11:21270312-21270334 ATATACAGATTAAAAGCAAATGG + Intronic
1080175090 11:29353819-29353841 CTTTTAAGATGAAAAGCAGATGG + Intergenic
1080763389 11:35273959-35273981 CTTTACAGATGAAAAGGAGAGGG + Intronic
1080880254 11:36313082-36313104 CTGTGTAGTTGCAAAGCAAATGG + Intronic
1081887261 11:46508477-46508499 CTGGAGACATGAAAATTAAAGGG + Intronic
1082874541 11:57974749-57974771 AGGTAGAAAAGAAAAGCAAAAGG - Intergenic
1082943824 11:58737007-58737029 CTGAAAAGTTGAAAATCAAAAGG + Intergenic
1083902174 11:65648895-65648917 CTTTAGAAAAGAAAAGGAAAAGG + Intronic
1085907512 11:80782269-80782291 CTGTAGTGATGGATAGCAAGTGG + Intergenic
1086815910 11:91370441-91370463 TTTTCAAGATGAAAAGCAAATGG + Intergenic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1087058976 11:93960098-93960120 CTGGAGAAATAAAAAGCCAAGGG + Intergenic
1088108570 11:106233640-106233662 CTGTAGAGCAGAAAAGAAGATGG - Intergenic
1088556579 11:111067429-111067451 ATGTAGAGATGTCAATCAAAGGG - Intergenic
1088976897 11:114823717-114823739 CTGTCCAGATCAAAAGCCAATGG + Intergenic
1089044020 11:115483538-115483560 TTTTAGACATGAAAAGCAAGAGG + Intronic
1091382219 12:69206-69228 CTGAAGAGATGCAAAGAAAGTGG - Intronic
1091640742 12:2235217-2235239 CAGTAGAGAAGAAATGGAAAGGG - Intronic
1092388105 12:8051132-8051154 CTGTTGAAAAGAAAAGAAAAGGG - Intronic
1092600304 12:10053744-10053766 CTGCAGAGAGGAAAAAAAAAAGG - Intronic
1093482806 12:19622721-19622743 CTATTGAGAGGAAAAGAAAAAGG + Intronic
1093569292 12:20647685-20647707 CTGTGGAAATGAACAGCAATGGG - Intronic
1093709101 12:22309237-22309259 CTTTAGGGAAGAAAAGCTAATGG - Intronic
1095520273 12:43055663-43055685 TTCTAGAGATAAATAGCAAAAGG - Intergenic
1099896000 12:88647679-88647701 CTGTATAGAAAAAAAGAAAACGG - Intergenic
1100340461 12:93674668-93674690 TTTTAGAGAGGAAAAGCAAGTGG - Intergenic
1101488682 12:105192223-105192245 CGGCAGAGATGAAAAGTAGATGG - Intronic
1101844885 12:108355392-108355414 CTGAAGAAAGAAAAAGCAAATGG + Intergenic
1102786018 12:115605532-115605554 CAGCAGAGAGGAAAAGGAAAAGG + Intergenic
1102936797 12:116904221-116904243 CTGGAGAAATGAAAAGGGAAGGG + Intergenic
1104723395 12:131059532-131059554 CTGTATAAAGGAAAACCAAATGG - Intronic
1105775448 13:23655154-23655176 CTGAATAGAAGAAAAGGAAATGG - Intronic
1105964622 13:25372713-25372735 CTGCAGAGCTCAAAAGCAGAGGG + Intronic
1107389765 13:39951752-39951774 TTGTGGAGATAAAAAGGAAAGGG - Intergenic
1108218617 13:48210595-48210617 CTATAGAAAGGAAAAGAAAACGG + Intergenic
1108784503 13:53879179-53879201 CTTTAGACAAGAGAAGCAAAGGG + Intergenic
1108798130 13:54058248-54058270 CTGTACAGATGAACTGCAATAGG - Intergenic
1110028882 13:70579866-70579888 CTAGAGAAATGAAAAGCAAATGG + Intergenic
1110159268 13:72356078-72356100 GAGTAGAGATGAAGAACAAAGGG - Intergenic
1111182572 13:84687761-84687783 CAGCAGAGAAGAAAAGCAACTGG - Intergenic
1111839314 13:93429516-93429538 GTCTAGACATGAGAAGCAAAGGG - Intronic
1113177505 13:107581703-107581725 CTGTACAGCTCATAAGCAAATGG + Intronic
1113380832 13:109804359-109804381 CTGTTGAGATGAAAAGGGAGTGG - Intergenic
1113385505 13:109844219-109844241 CAGTAGAGAAGAAAAACAATAGG - Intergenic
1114421098 14:22583557-22583579 CTGTAATGATGGAAAGGAAATGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115116271 14:29883985-29884007 CTGCAGAGATGATCATCAAATGG + Intronic
1115149581 14:30269093-30269115 CTGTAGAGTAGACAAGGAAATGG + Intergenic
1115349896 14:32382610-32382632 ATGAAAAGATGAAAAGCATAAGG - Intronic
1115909829 14:38243056-38243078 CGGAAGAGATGAAGTGCAAATGG + Intergenic
1117818164 14:59619815-59619837 CTGTAGACATAACAAGGAAATGG + Intronic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1119745273 14:77039384-77039406 CTGCAGAGTTGTAAAGCAAAGGG - Intergenic
1120149639 14:81019017-81019039 CAGAAGAAATGAAAAGAAAAAGG + Intronic
1120419870 14:84270528-84270550 CTTTAAAAATTAAAAGCAAATGG + Intergenic
1120720210 14:87882215-87882237 CTGTAGATATGAAATTCTAAAGG - Intronic
1121490584 14:94356215-94356237 CTGTAAAGAAGAAAATAAAATGG + Intergenic
1121902708 14:97708565-97708587 AAGTAGATATGAAAAACAAAAGG + Intergenic
1122015379 14:98790732-98790754 CTGTAGAGAAGCAAAGAACATGG + Intergenic
1122811077 14:104288285-104288307 GAGTAGGGATGAAGAGCAAATGG - Intergenic
1202901337 14_GL000194v1_random:42285-42307 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1125027195 15:35042513-35042535 CTTTAGAAATGAAAACGAAATGG - Intergenic
1125093294 15:35820555-35820577 CTGTGGAAATAAAAAGGAAAAGG - Intergenic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1126982551 15:54260447-54260469 CTGTTGAGAAAAATAGCAAAAGG + Intronic
1128539653 15:68517737-68517759 CTGGAGAGGTGAGGAGCAAATGG + Intergenic
1128724480 15:69977978-69978000 CTGTAGAGAGGAAAGACAACTGG + Intergenic
1128756113 15:70185185-70185207 CTGCAGAGGTGAGAAGCAGAGGG + Intergenic
1128945200 15:71815025-71815047 CTGTAGAGATGCCAAGCACATGG + Intronic
1129531024 15:76264845-76264867 ATGTAGAAATGGAAATCAAAAGG + Intronic
1129980481 15:79864784-79864806 CTTTAGAAAGGAAAAGAAAAAGG + Intronic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130796398 15:87214370-87214392 CTTTAGAGAAGAAAAGCATCTGG - Intergenic
1130899596 15:88197288-88197310 CTGTAGAAATAAAAAGACAAGGG - Intronic
1131412062 15:92216907-92216929 CATTAAAAATGAAAAGCAAATGG + Intergenic
1131906388 15:97147611-97147633 TTGGAGGCATGAAAAGCAAAAGG - Intergenic
1132410420 15:101573814-101573836 AGGGAGAAATGAAAAGCAAAGGG + Intergenic
1135503952 16:23020285-23020307 CTGTAGAGAAAGAAAGGAAATGG - Intergenic
1135664568 16:24325080-24325102 CTGTAGAGATGCCAGGCACAGGG + Intronic
1136425152 16:30165226-30165248 CGGTAGTGATGAAGAGAAAAGGG + Intergenic
1138239759 16:55417937-55417959 CTTAGGAGATGTAAAGCAAAAGG + Intronic
1138660999 16:58516702-58516724 CTATAGAGTTGTAAAGAAAAGGG - Intronic
1138924235 16:61571181-61571203 TTCTAGAGATGTACAGCAAAAGG - Intergenic
1139240515 16:65387142-65387164 CTGTAGAGATGGAAAACATGTGG - Intergenic
1140520784 16:75579673-75579695 CTAAAGAGAAGAAAACCAAAAGG + Intergenic
1141330612 16:83107818-83107840 CTCAAGAAAAGAAAAGCAAAAGG - Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143416311 17:6753542-6753564 CTTGAGAAATGAAAAGAAAATGG + Intergenic
1143614701 17:8042783-8042805 TTGCAGAGATGAAAATCAAGGGG + Exonic
1143925021 17:10361976-10361998 ATTTGGGGATGAAAAGCAAAGGG - Intronic
1144040855 17:11409966-11409988 ATATGGAGATGAAAAGAAAATGG + Intronic
1144087411 17:11823201-11823223 ATGTAGAGAAAAAAAGCCAAAGG - Intronic
1144470181 17:15532504-15532526 CTGTGGAGCTGAGAAGAAAATGG + Intronic
1144926159 17:18811144-18811166 CTGTGGAGCTGAGAAGAAAATGG - Intergenic
1145195205 17:20887414-20887436 CTTTAGGGATGAAATGCAAAAGG + Intronic
1146340307 17:32013132-32013154 ATATATAGATTAAAAGCAAAAGG - Intronic
1146807340 17:35875461-35875483 GTGCAGAGATGAAAAGGGAACGG + Intronic
1148962466 17:51405007-51405029 CTGTGGAGAGGAACAGCAACAGG + Intergenic
1149964190 17:61145517-61145539 CTTTGGAGATGAAAAACAGACGG + Intronic
1150903767 17:69314960-69314982 AGGTAGAGAAGAAAAGCAAAAGG - Intronic
1150907963 17:69358854-69358876 GTGAAGAGAGGAAGAGCAAAAGG - Intergenic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1152602672 17:81272628-81272650 CTGTACAAAAGAAAAACAAAAGG + Intronic
1153161409 18:2208396-2208418 TTGTAGACATGAAAACCACACGG + Intergenic
1153398595 18:4654814-4654836 CTACAGAGATGAAAACCAAGTGG + Intergenic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1155813231 18:30266870-30266892 CTGTAGAGATGCAAGGTCAAGGG + Intergenic
1156673292 18:39497207-39497229 CTGTATAGATGTAAAGGAAAAGG + Intergenic
1157131144 18:45008524-45008546 TTGCAGAGATGGAAAGAAAAAGG + Intronic
1157192331 18:45591961-45591983 CTGAAGAGGTTAAAATCAAAAGG - Intronic
1157958333 18:52124453-52124475 ATGAACAGATGAAAAGCAAAGGG + Intergenic
1158869336 18:61669408-61669430 CTGTAAAAATGTTAAGCAAATGG - Intergenic
1159429765 18:68336613-68336635 CTGAAAAGATGCACAGCAAAGGG - Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1159538616 18:69747271-69747293 CTAGAGAGATAAAGAGCAAAAGG + Intronic
1161403074 19:4077557-4077579 CTGCAGAGAAGAAAAGCCACTGG + Intergenic
1165214365 19:34259292-34259314 GTGTAGGGATAGAAAGCAAATGG - Intronic
1167172742 19:47844026-47844048 GGGAAGAGATGGAAAGCAAAGGG - Intergenic
926543563 2:14210235-14210257 CTATAGACAAGAAAAGTAAAGGG - Intergenic
927024415 2:19050704-19050726 CTGGAGAGAAGGAAAGCAATGGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928321734 2:30289209-30289231 ATGTAGAGATGAATTGCAAATGG + Intronic
928712578 2:34023982-34024004 CTGAAGAGAAAAAAAGGAAATGG - Intergenic
928942742 2:36742872-36742894 CTGCTGAGAACAAAAGCAAAAGG - Intronic
929479919 2:42295918-42295940 CTGCAGTGAGGAAAAGAAAAAGG - Intronic
929529892 2:42743133-42743155 CTGGAGAGAAGAAAGGCAGATGG + Intronic
929812115 2:45199502-45199524 CAGAAGAGTGGAAAAGCAAAGGG - Intergenic
929951507 2:46413446-46413468 CTGTAGAGGTAATAAGGAAAAGG + Intergenic
929974153 2:46616250-46616272 CACTAGGCATGAAAAGCAAACGG + Intronic
930246918 2:48993114-48993136 CTATAGAAAAGAGAAGCAAAAGG - Intronic
930401798 2:50899454-50899476 CTGGAGAGAAGAAAATGAAAAGG - Intronic
930564672 2:53004421-53004443 ATGAAGAGAAGAAAAGTAAAAGG + Intergenic
931281357 2:60795267-60795289 CTTTAAAGATAAAAAACAAAGGG - Intronic
931740705 2:65240054-65240076 ATGTTGCCATGAAAAGCAAAGGG + Intronic
932504763 2:72217995-72218017 CTTTACAGATGAAAAGAATAAGG + Intronic
933469967 2:82709797-82709819 CTATAGATATGAAACACAAAAGG - Intergenic
934288031 2:91665959-91665981 CTGTAAATGTGAAAAGCCAATGG - Intergenic
934505444 2:94888834-94888856 CTATAAAAATGCAAAGCAAAGGG + Intergenic
934589494 2:95533452-95533474 CTTTGGAAATGAAAAGGAAAAGG - Intergenic
934676312 2:96252319-96252341 CTGCTGAGCTGAAAAGGAAATGG - Exonic
934753068 2:96806462-96806484 GAGTAGAGATGAAGAACAAAGGG - Intronic
937842639 2:126539076-126539098 CTGTAGAGAAAATAGGCAAATGG - Intergenic
937909669 2:127069305-127069327 CTGTGGAGATGAGAAGCCAGGGG - Intronic
938746657 2:134285037-134285059 CGGTAAAGAAGAAAATCAAAGGG - Intronic
938860927 2:135367648-135367670 CCGTAGAGAAGAAAACCATATGG - Intronic
939579543 2:143931544-143931566 TTGTAGAGAGGAAAAGAAAATGG - Intergenic
940555434 2:155221099-155221121 CTATAGAGATAAAGAGCAGAAGG + Intergenic
941599749 2:167527739-167527761 TTTTAGAGAGGAAAAGCACAAGG - Intergenic
941976998 2:171416257-171416279 GTGTAGAGATGACCAGCAGAGGG - Intronic
943486398 2:188489739-188489761 CTGTAGAGAGGACAAGGGAAAGG - Intronic
945291802 2:208134392-208134414 CAGTGGAGATAATAAGCAAAAGG + Intergenic
945825096 2:214712066-214712088 CAATAGAGAAGAAAAGCAACAGG + Intergenic
945830027 2:214772663-214772685 CTGTATAGCTGATTAGCAAACGG + Intronic
946185195 2:217976827-217976849 GTCAAGAGATGGAAAGCAAAAGG + Intronic
946540069 2:220674783-220674805 CAGTACAGATGAAAAGGAGAGGG + Intergenic
946636262 2:221730865-221730887 CAGCAAAGATGAAAAGCAGAAGG + Intergenic
946912015 2:224472634-224472656 ATGTAGAGATAAAGAGCACAAGG + Exonic
946953076 2:224898429-224898451 ATGTAGAGAAGAATAGTAAAAGG + Intronic
946955486 2:224925301-224925323 CTTTAGCAATGAAAAGCAAATGG - Intronic
947027739 2:225757695-225757717 CTGTAAATATTAAAAGCACATGG + Intergenic
948373100 2:237503220-237503242 CTCTAGAGATGAAAAAAATAGGG + Intronic
1169681126 20:8215020-8215042 CTGTGGAGCTGAGAAGGAAAAGG - Intronic
1169755717 20:9040767-9040789 ATGGAGTGATGCAAAGCAAAAGG + Intergenic
1173848285 20:46201623-46201645 CAGTAAACATGAAAAGCATAAGG - Intronic
1175791707 20:61744168-61744190 CTGGAGGGATGAGAAGCAAGCGG + Intronic
1176282981 20:64325627-64325649 CTGAAGAGATGCAAAGAAAGTGG + Intergenic
1176620712 21:9057063-9057085 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1176675852 21:9776460-9776482 CTCCAGAGATGAAAACCACAAGG + Intergenic
1178329915 21:31679193-31679215 CTGTAGAGATCAAATCAAAACGG - Intronic
1181679106 22:24479129-24479151 CTGTGGAAATGAAAATCAAAGGG - Intergenic
1181898135 22:26129237-26129259 CTGTAGAAAGCAAAAGCAAAAGG - Intergenic
1182174306 22:28268066-28268088 GTAAAGAGATTAAAAGCAAATGG + Intronic
1182311019 22:29406641-29406663 AGGTAGAGTTGAAAAGCAGACGG + Intronic
1182690088 22:32154458-32154480 AGGTAGAGTTGAAAAGCAGACGG - Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183144960 22:35981959-35981981 CTGTAGAGAGGCACACCAAAGGG + Intronic
1183707869 22:39485893-39485915 CTGTATAAATGAATAGCAAATGG + Intronic
949197186 3:1325720-1325742 CTGTAGAGATCAGAAGGACAAGG - Intronic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
953610790 3:44445784-44445806 CTTTACAGATGACAAACAAATGG - Exonic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
955448574 3:59041812-59041834 TTTTACAGATGAAAAGTAAAAGG - Intronic
955809318 3:62769919-62769941 CTAAAAAGATGAAAAGGAAATGG + Intronic
957660126 3:83139230-83139252 CTGAGTAGATGAAAAGCAAAGGG + Intergenic
958441137 3:94157543-94157565 TTGTAGAGAAGAAGAGCAAATGG + Intergenic
958472405 3:94537393-94537415 CTGAAGACATGGAAATCAAATGG - Intergenic
959139253 3:102465514-102465536 CTGTAAAGAGAAACAGCAAAAGG + Intronic
959670424 3:108971091-108971113 TTGCAGAGATGAAAAGAAACAGG - Intronic
960036605 3:113108681-113108703 CTGAAGAAAGGAAAAGAAAAAGG + Intergenic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
961342819 3:126240193-126240215 CTATAGAGACAGAAAGCAAATGG + Intergenic
962050020 3:131803391-131803413 TTCTAGAGAACAAAAGCAAAAGG + Intronic
962747503 3:138408075-138408097 CAGTGGAGGTGACAAGCAAAGGG - Intergenic
963227598 3:142878062-142878084 CTGTCAAGAAGAAAAGCACAGGG - Intronic
963723597 3:148892853-148892875 CTGTAGAGAGGAGAAGCACTTGG + Intronic
963781768 3:149493716-149493738 CTGAAGAGAGGACAAACAAATGG + Intronic
963817729 3:149851332-149851354 CTGGAGAGATGCAAGGCAACTGG + Intronic
964682499 3:159357983-159358005 CTGTAGATATGAGAAGGTAAGGG + Intronic
965130218 3:164689345-164689367 CTGTAAAGATGAAAACAATAAGG - Intergenic
965299714 3:166994822-166994844 ATGGAGAGATGAAAAGGAAATGG + Intergenic
965467899 3:169055169-169055191 CAGTAGAGATGAAAAGTCTAGGG - Intergenic
966640881 3:182188165-182188187 CTGATGAGATGGAAAACAAATGG - Intergenic
967931003 3:194690073-194690095 CTTTAAAAAAGAAAAGCAAAGGG + Intergenic
968159202 3:196411434-196411456 CTGTGGAAATAAATAGCAAATGG + Intronic
969893619 4:10282408-10282430 TTGTGGCAATGAAAAGCAAAAGG - Intergenic
969948319 4:10807375-10807397 CTGCTGTGATGATAAGCAAAGGG + Intergenic
970834457 4:20385202-20385224 CTGTTGTAATGAAAATCAAATGG + Intronic
971008471 4:22403327-22403349 CTGAAGAGGTGAAAATCACAGGG + Intronic
971428626 4:26540740-26540762 CTATAGAGATGAAAAAGAAGTGG - Intergenic
971444391 4:26727185-26727207 CTGAAGTGATGAGAGGCAAAGGG + Intronic
971468075 4:26987149-26987171 CAATAGAGAAGAAAAGCAACTGG - Intronic
971592177 4:28482220-28482242 CTGTTGTGTTAAAAAGCAAAGGG + Intergenic
971895033 4:32581067-32581089 CTGTTGAGAGAAAAAGAAAAAGG - Intergenic
972330454 4:38059480-38059502 CTGTTTAAATGTAAAGCAAATGG + Intronic
972449391 4:39181729-39181751 ATGTCGAAAAGAAAAGCAAAAGG + Intergenic
973171825 4:47154839-47154861 CTGTAGAGAAAGAAAGAAAATGG - Intronic
973984638 4:56338607-56338629 TTGTAGTTATGGAAAGCAAACGG + Exonic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
975457665 4:74611387-74611409 TTATAGAGATTAAAATCAAATGG - Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
975990992 4:80260009-80260031 CTACTGAAATGAAAAGCAAATGG + Intergenic
976663503 4:87565226-87565248 CTGTAGTTCTAAAAAGCAAAGGG + Intergenic
976778847 4:88736596-88736618 CTCTAGAGATGAAAAATCAAAGG - Intronic
977048154 4:92092307-92092329 ATTTAGAGAAGAAAAGCATATGG - Intergenic
977569183 4:98612179-98612201 CTGAAGAGATGAGAAGCAGGAGG + Intronic
977692347 4:99928205-99928227 TTGCAGAGGAGAAAAGCAAAGGG - Intronic
977781036 4:100981127-100981149 ATGTAAAGATGAAATTCAAAGGG - Intergenic
978015589 4:103741464-103741486 CTGTAGATATGAAAACCAGGGGG - Intergenic
978526160 4:109668500-109668522 ATATATAGATGAAAAGCAAAGGG - Intronic
978764194 4:112387568-112387590 TTGTAGAGTTGAAAAGGACATGG - Intronic
980341800 4:131559751-131559773 CAGAAGAGATAAAAAGAAAATGG - Intergenic
982673600 4:158350379-158350401 CAGTGGAGCTGAAAAGGAAATGG - Intronic
983164186 4:164454300-164454322 CTGTAAAGACTAAAAGCAAAAGG + Intergenic
983354195 4:166634505-166634527 ATGGACAGATTAAAAGCAAAGGG - Intergenic
983441983 4:167798119-167798141 CTGAAAACATGAAAAGCCAATGG + Intergenic
983953084 4:173665013-173665035 CAGTAGATATTAAAAGTAAAGGG - Intergenic
984699051 4:182806935-182806957 CTGTTAACATGAAAAGTAAAAGG - Intergenic
985246183 4:187981996-187982018 CTGTAGAGATGAATATGACATGG + Intergenic
985399689 4:189582242-189582264 CTCCAGAGATGAAAACCACAAGG - Intergenic
986174812 5:5342983-5343005 CTGGAGTCATCAAAAGCAAAGGG - Intergenic
986748779 5:10766509-10766531 ATTTAGAGAAGAAAAGAAAATGG - Intergenic
986759769 5:10869279-10869301 CTTCAGAGATGTAAAGCCAATGG + Intergenic
988062870 5:26196323-26196345 ATGAAGATATAAAAAGCAAATGG - Intergenic
989393538 5:40927647-40927669 CTGAAGAGAAGACATGCAAATGG + Intronic
990346131 5:54873564-54873586 CTGAAGAGATGAGATACAAAAGG - Intergenic
990361014 5:55020098-55020120 CTCTAAAGAAGAAAAGAAAAAGG + Intronic
990987225 5:61652015-61652037 CGGAAGAGTAGAAAAGCAAAAGG - Intronic
991204376 5:64033549-64033571 ATGAAGAAATGAAAAGAAAATGG - Intergenic
991699005 5:69299765-69299787 CTGTAAAGATGAGAAATAAACGG + Intronic
992000782 5:72434238-72434260 CCTTAGAGATGAAGGGCAAATGG + Intergenic
992211258 5:74482008-74482030 CTTTATACATGAAAAGCTAAAGG - Intergenic
993036648 5:82766242-82766264 CAAGAGAGATGAAAAGCACAAGG + Intergenic
993407875 5:87534546-87534568 CTGTACAGATGAAAGCCAGAAGG - Intergenic
993463811 5:88219629-88219651 AGGTATACATGAAAAGCAAAAGG + Intronic
995721367 5:115137896-115137918 CTTTGGAGATGAAAAGCTTAAGG - Intronic
995779305 5:115758810-115758832 CAATAGAAATGAAAAGCAAATGG + Intergenic
995882318 5:116856977-116856999 ATGAAGAGATGGAAAGAAAAAGG - Intergenic
995897375 5:117030504-117030526 CAGTGTAGATGCAAAGCAAAGGG + Intergenic
996481496 5:123980653-123980675 CTGTAGATCTGAAAAACTAAAGG - Intergenic
1000195709 5:158955452-158955474 TTGTTGATATGAAAAGCAGAAGG - Intronic
1004005261 6:11632272-11632294 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1004005604 6:11634658-11634680 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1004281493 6:14283189-14283211 CTAAGGAGATGAAAAGAAAAGGG + Intergenic
1004307436 6:14513839-14513861 CAGAAGAGAAGAAAAGAAAAAGG + Intergenic
1004820776 6:19365780-19365802 CTGTAGAGAGGAAGACCAAGTGG - Intergenic
1004863229 6:19827691-19827713 CTGTTGACATGGGAAGCAAAAGG - Intergenic
1005092093 6:22068122-22068144 TTCTAGAGATGAAAAGCTATAGG - Intergenic
1005477610 6:26223333-26223355 GTGTGGAGAGGAAAAGCACAGGG + Intergenic
1007296174 6:40823093-40823115 CTGGAGAGCTGAAAAGGCAAAGG + Intergenic
1007944286 6:45811527-45811549 CTGTAGCGATGATAAGCAGCTGG - Intergenic
1008747360 6:54688654-54688676 GTGTAGAGATTAAAATAAAATGG + Intergenic
1009443386 6:63709892-63709914 ATGTAGAGAGAAAAAGGAAAAGG - Intronic
1009879029 6:69541795-69541817 GTTTATAGATGAAAAGCCAAAGG + Intergenic
1010737069 6:79455063-79455085 CTGTAGAGAAAAAAAACCAAGGG + Intergenic
1010917826 6:81642236-81642258 GTTTAGAGATGAAAAGAAGAGGG + Intronic
1010941112 6:81918682-81918704 CTATTGAGAAGAGAAGCAAAAGG - Intergenic
1010976632 6:82322936-82322958 CTTTAGAGTAGAAAAGCAATAGG - Intergenic
1011191815 6:84737519-84737541 CTACAGAGATGAAAAGGAGATGG + Intronic
1011363812 6:86557861-86557883 ATGTAGACATGCAAACCAAAAGG - Intergenic
1011695518 6:89909295-89909317 TTGTAGAGATGAAAAGAATGTGG + Intergenic
1012080560 6:94752635-94752657 TTTTAGAGATGAGAAGTAAATGG + Intergenic
1012760044 6:103289371-103289393 CTATAGAGATAAATAGCAATAGG + Intergenic
1012781088 6:103558469-103558491 CAGTAGCGAAGAAAAGCAGAGGG - Intergenic
1013580633 6:111530834-111530856 GTTTAGAGATGAAAGGCAAGAGG - Intergenic
1013968951 6:115992224-115992246 TAGTAGAGAGTAAAAGCAAATGG - Intronic
1014489508 6:122044816-122044838 CTTGATAGATGGAAAGCAAATGG + Intergenic
1014847101 6:126290730-126290752 CTATAAAGTTAAAAAGCAAATGG + Intergenic
1015118825 6:129679105-129679127 CAGTAGAGATAAAACCCAAATGG - Intronic
1015131652 6:129817939-129817961 CTGTTGAGATGAGAGGCAATTGG + Intergenic
1015671526 6:135696147-135696169 TTTTAAAAATGAAAAGCAAAAGG - Intergenic
1017954647 6:159168532-159168554 CTGCAGAGAGGAAAAAAAAAAGG - Intergenic
1018301795 6:162410543-162410565 CAGTAGAAAAGAAAAACAAAAGG - Intronic
1018674293 6:166205738-166205760 CTTTAGATATGAAGACCAAAAGG + Intergenic
1020071785 7:5232029-5232051 CTGTAAATATGAAAAGGGAAGGG - Exonic
1020624843 7:10565155-10565177 ATATAGAAATGAAAAGTAAAAGG + Intergenic
1020650444 7:10868657-10868679 CTGTAGAAACAAAAAGGAAATGG + Intergenic
1021326715 7:19279795-19279817 CCGTAGAGCAGAACAGCAAAAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022499323 7:30872725-30872747 CTGTAAAGATGCAAAGGGAAGGG - Intronic
1022884070 7:34623447-34623469 ATGTTGAGGAGAAAAGCAAAGGG + Intergenic
1024395715 7:48864475-48864497 CTGTGGAGTTGAAAAGTACATGG - Intergenic
1024399518 7:48907801-48907823 CTGTGGAGTTGAAAAGTACATGG + Intergenic
1024644761 7:51361870-51361892 GTGTGGAGTGGAAAAGCAAATGG - Intergenic
1026064880 7:67061759-67061781 CAATAGGGAGGAAAAGCAAATGG + Intronic
1026357864 7:69575180-69575202 CTGAAGAGATGAAAGGCAGGAGG + Intergenic
1026433387 7:70370366-70370388 CTATAGAGATGAAAAATAGAGGG - Intronic
1026567240 7:71499676-71499698 CTGTATAGATGAAGAGAAATCGG - Intronic
1027448518 7:78302677-78302699 CCCTAGACATGAAAGGCAAAAGG + Intronic
1028109328 7:86920421-86920443 CAGTAGGGATAAAAAGCAGAAGG + Intronic
1028662912 7:93302045-93302067 CTGTAAAGAAGAAACACAAAAGG - Intronic
1028663038 7:93304917-93304939 ATGTATAGTTGAAATGCAAAAGG + Intronic
1029067471 7:97866204-97866226 CTATAAAAATGTAAAGCAAAGGG + Intronic
1029331508 7:99860122-99860144 CTGTAAAGAGTAAAAACAAAGGG + Intronic
1029345051 7:99972368-99972390 CTCTAGGGATGAGAAACAAAAGG - Intronic
1030719831 7:112857389-112857411 CTGTAAAGATTAAAAGAACATGG - Intronic
1031605341 7:123762073-123762095 CAGAAGAGATGAAAAGGAAGTGG - Intergenic
1031711814 7:125057261-125057283 CACTAGGGATGGAAAGCAAAAGG - Intergenic
1033031121 7:137827813-137827835 CAGGAGAGATTAGAAGCAAATGG + Intronic
1033085839 7:138341080-138341102 ATGTAGAAAAGAAAATCAAAAGG + Intergenic
1033168102 7:139058728-139058750 CTGGAGAGGGGAAGAGCAAATGG + Intronic
1034351826 7:150420994-150421016 CATTAGAGATGACAGGCAAAGGG - Intergenic
1034380097 7:150684456-150684478 CTGTTGAGATGAAGATAAAATGG - Intergenic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1037401668 8:18500415-18500437 CTGAAGAAAAGAAAAGCCAAAGG + Intergenic
1037520636 8:19677463-19677485 CAGTAGAGAAGAAAAACTAATGG + Intronic
1037595901 8:20353858-20353880 CAGGAGAGAGGAAAAGGAAAAGG - Intergenic
1038216671 8:25567924-25567946 TTCTAGAGATGAGAAGCAAAGGG - Intergenic
1040354612 8:46605402-46605424 CTATAAAAATGTAAAGCAAAGGG + Intergenic
1041506310 8:58601874-58601896 CTGCAGACAAGAAATGCAAATGG + Intronic
1041891285 8:62871746-62871768 CTGGAGATATGAAAAGTTAAAGG - Intronic
1042067789 8:64897914-64897936 CTGTTTAGATGAAAATTAAAAGG + Intergenic
1042074944 8:64982959-64982981 CTATAGAGTTGAAAGACAAAAGG + Intergenic
1042198995 8:66261006-66261028 CTGTAAAAATGAAAGACAAAGGG + Intergenic
1042893903 8:73644774-73644796 CTGTAGACATCAAAAGAATAAGG + Intronic
1043733030 8:83708816-83708838 TTGTTGAGATGTAAAGAAAAGGG - Intergenic
1044387768 8:91610167-91610189 GTGTAGACAAGAAAAGCTAAGGG + Intergenic
1044457764 8:92408251-92408273 ATGTACAGATGAAAAAAAAAAGG - Intergenic
1044871454 8:96624205-96624227 CTGTAGAGATAAAAGGCTAAAGG + Intergenic
1045282829 8:100764362-100764384 ATGTAAAGAACAAAAGCAAAAGG + Intergenic
1045537878 8:103049992-103050014 CTGTAGAGAATGAAAGGAAAAGG - Intronic
1045709459 8:104966049-104966071 CTATAAAGCTGAAAAGCATAGGG + Intronic
1046132564 8:109985124-109985146 ATGTAGAGAACAAAAGCTAATGG - Intergenic
1046302520 8:112315150-112315172 GTGTAGAGCTGAAAGGCAACTGG - Intronic
1047655937 8:126977180-126977202 AGGTGGAGAAGAAAAGCAAAAGG - Intergenic
1047777134 8:128081760-128081782 CTGTACAGATGAAAACACAAAGG + Intergenic
1048724437 8:137366522-137366544 CTCTACAGATGAAAAGGAAAGGG - Intergenic
1048899688 8:139025393-139025415 GGGAAGAGAAGAAAAGCAAAGGG - Intergenic
1050005631 9:1127106-1127128 ATGTAGAGATGAAAAGAACATGG + Intergenic
1050152933 9:2635111-2635133 ATGAAGAGATGGAAAGAAAATGG + Intronic
1050462214 9:5886562-5886584 CTGAAGAGATGAAGTGCAAGTGG + Intronic
1050522170 9:6512207-6512229 CTTTAAGGAGGAAAAGCAAACGG - Intergenic
1050751046 9:8937576-8937598 CTGTAGAGGTGAAAAGGAATAGG - Intronic
1050850798 9:10283792-10283814 CTGTAGTGTTGCAAAGCATAAGG - Intronic
1051367556 9:16331919-16331941 CAGTAGAAAAGGAAAGCAAAGGG + Intergenic
1051667549 9:19479774-19479796 CTGAAGGGATGAAAATCCAAAGG + Intergenic
1052084457 9:24247497-24247519 GTGTAGAGAAGAAAATGAAAAGG + Intergenic
1055082903 9:72284728-72284750 CTGAAAAAATGATAAGCAAATGG - Intergenic
1055347335 9:75352697-75352719 CTTTGGAGATGAAGAGTAAAGGG + Intergenic
1055562428 9:77534240-77534262 CTTTAAAGATGAAAAGTAAACGG - Intronic
1056032828 9:82570595-82570617 CTGTACAGATGGCAAGCCAATGG - Intergenic
1057842462 9:98497025-98497047 CTATGGATGTGAAAAGCAAAGGG + Intronic
1058192123 9:101931081-101931103 CTTTTGATATGAAAATCAAAAGG - Intergenic
1058245503 9:102619334-102619356 AGGTAGAGAAGAAAAGTAAATGG - Intergenic
1058627379 9:106949261-106949283 CTCTAGAAATGAATAGGAAATGG - Intronic
1058765824 9:108181732-108181754 CTCTAGAGCAGAAAGGCAAATGG - Intergenic
1058940751 9:109810635-109810657 CTGTAAAGAGGAATAGAAAATGG + Intronic
1059622886 9:116027963-116027985 TTGTAGAGATGAGAATAAAATGG + Intergenic
1059748165 9:117222871-117222893 GTGTACAGATGAAAAAAAAAAGG + Intronic
1059772599 9:117441873-117441895 CTCTTGCAATGAAAAGCAAAGGG - Intergenic
1061706035 9:132453838-132453860 TTGTAAATGTGAAAAGCAAATGG - Intronic
1062255486 9:135618910-135618932 CTGTGGAGCAGAAAAGAAAAAGG - Intergenic
1062258266 9:135641686-135641708 CAATGGAAATGAAAAGCAAAAGG - Intergenic
1203743922 Un_GL000218v1:27506-27528 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1203566191 Un_KI270744v1:92029-92051 CTATAAAAATGTAAAGCAAAGGG + Intergenic
1185591903 X:1282863-1282885 CATTAGAGATGAAATGCAGATGG - Intronic
1186733490 X:12435853-12435875 CTGAAGAGATCAAAAGCAATTGG - Intronic
1186733567 X:12436710-12436732 CAGTAAAGAAAAAAAGCAAAAGG - Intronic
1187081609 X:15995494-15995516 CAGAAGAGATGGAAGGCAAAAGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188366241 X:29318512-29318534 CTGTAAAGAAATAAAGCAAAAGG + Intronic
1189044737 X:37578425-37578447 CCAAAGAGATGAAAAGCGAATGG - Intronic
1189255046 X:39631452-39631474 GGGTGGAGATCAAAAGCAAAGGG - Intergenic
1189961283 X:46327126-46327148 ATTTAGAGATGAATTGCAAATGG - Intergenic
1190167085 X:48082139-48082161 CAGCAGAGATGAAAATTAAATGG + Intergenic
1192007243 X:67229665-67229687 CAGTAAACATGAAAAGCAAATGG + Intergenic
1193837859 X:86367915-86367937 TGGTGGAGATGAAAATCAAAAGG - Intronic
1194135523 X:90135862-90135884 ATGAAGAGATAAAAAGGAAAAGG - Intergenic
1195482820 X:105367155-105367177 CCATAGAAATAAAAAGCAAAGGG - Intronic
1195538557 X:106036510-106036532 ATGTGGAGATGCAAACCAAAGGG - Exonic
1195564869 X:106328828-106328850 TTGTGGAGAGAAAAAGCAAATGG + Intergenic
1195916145 X:109937739-109937761 ACCTAGACATGAAAAGCAAATGG + Intergenic
1196146155 X:112319316-112319338 CATTAAAGAAGAAAAGCAAAAGG - Intergenic
1197715952 X:129706220-129706242 CTGTACAGAAGTCAAGCAAACGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199203271 X:145118502-145118524 CTCAAAAGAAGAAAAGCAAATGG + Intergenic
1200735572 Y:6790400-6790422 CTTCAGAAATGAAAAGAAAAGGG - Intergenic
1201157245 Y:11142491-11142513 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1201342263 Y:12947375-12947397 CTGTTGAGTTGAAAAGCAGGTGG + Intergenic