ID: 1118335036

View in Genome Browser
Species Human (GRCh38)
Location 14:64846222-64846244
Sequence ACTCTGCCCCAGAAGTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118335034_1118335036 18 Left 1118335034 14:64846181-64846203 CCGATCTCAACAACAGAACAAAG 0: 1
1: 0
2: 14
3: 234
4: 2344
Right 1118335036 14:64846222-64846244 ACTCTGCCCCAGAAGTAGAGTGG 0: 1
1: 0
2: 1
3: 11
4: 175
1118335033_1118335036 19 Left 1118335033 14:64846180-64846202 CCCGATCTCAACAACAGAACAAA 0: 1
1: 0
2: 8
3: 158
4: 1761
Right 1118335036 14:64846222-64846244 ACTCTGCCCCAGAAGTAGAGTGG 0: 1
1: 0
2: 1
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118335036 Original CRISPR ACTCTGCCCCAGAAGTAGAG TGG Intronic
900202403 1:1415696-1415718 ACTCTGCCGAATAACTAGAGTGG - Intergenic
901204522 1:7486445-7486467 AGTCTTGGCCAGAAGTAGAGAGG - Intronic
902091950 1:13910610-13910632 AGGCTTCCCCAGAAGCAGAGCGG + Intergenic
904483740 1:30810339-30810361 CCTCTGCCTTAGAAGCAGAGTGG + Intergenic
904624108 1:31792601-31792623 CCTCTGCTCTAGAAGTGGAGAGG + Intronic
906059399 1:42938561-42938583 ACTTTGCCCCACAAGTGGTGAGG - Intronic
908318130 1:62954444-62954466 ACTCTAACCCAGAACCAGAGTGG + Intergenic
908887490 1:68806322-68806344 AATCTGCCCCAGATGTGGGGAGG + Intergenic
910314430 1:85866221-85866243 ACTCTCACCCAGAAGTGCAGTGG - Intronic
912477501 1:109949090-109949112 CCTCAGCCCCAGAAGTAGCTGGG - Intergenic
915339203 1:155167090-155167112 ACTGAGCCCCAGAAGTCCAGGGG + Intergenic
915487114 1:156229294-156229316 ACTCTGACCCAGAAGTGTACTGG + Intronic
915557384 1:156668219-156668241 ACTCTGCCACACAATGAGAGAGG - Intergenic
917115913 1:171603316-171603338 ACTCTGCCGCATAACTAGAGTGG + Intergenic
918133324 1:181647397-181647419 ACTCTGTCACAGAAGTTGGGGGG + Intronic
920450255 1:206055392-206055414 ACTCTGCCGAATAACTAGAGTGG + Intronic
920916181 1:210259881-210259903 ACTGTTCCTCAGAAGTAGGGAGG - Intergenic
921927232 1:220721467-220721489 ACTCTGCCAAATAACTAGAGTGG + Intergenic
922327733 1:224544610-224544632 ACTCAGCCCTAGAGGTGGAGTGG - Intronic
922690237 1:227683257-227683279 ACTCTGCCAAATAACTAGAGTGG + Intergenic
924394773 1:243607064-243607086 ACTCTGCCCCTGCAGCAGACTGG - Intronic
1063350357 10:5348438-5348460 AGACTTCCCCAGAAATAGAGGGG - Intergenic
1063384770 10:5609310-5609332 ACTGAGCCCCAGAAGTCCAGTGG + Intergenic
1065642023 10:27792945-27792967 ACGCTGCCCCATAACTAGAATGG - Intergenic
1065703086 10:28444348-28444370 CCCCTGCCCCAGAAGGAGAATGG + Intergenic
1065796484 10:29312789-29312811 GCTCTGCCCCAGCAGAACAGAGG - Intronic
1067697451 10:48546179-48546201 ACACTGCCACAGGAGTAGCGGGG - Intronic
1069251281 10:66270318-66270340 CCTCAGCCCCACAAGTAGATGGG + Intronic
1069555448 10:69394794-69394816 GCTCTGCCGCAGAGGCAGAGTGG - Intronic
1071111457 10:82162518-82162540 ACTCTGCCCAAAAAGGAGTGGGG - Intronic
1071383973 10:85101243-85101265 ACCCTGACCTAGAAGTAAAGAGG - Intergenic
1073533314 10:104253100-104253122 TTTCTGCCCCAGAAGCAAAGTGG - Intronic
1075315266 10:121448001-121448023 ACTCTGCCCAAGAACAAGAGGGG - Intergenic
1075581953 10:123625598-123625620 ACTCAGCCCCAGAAGAAGAGTGG + Intergenic
1080724253 11:34879758-34879780 CCTCAGCCTCCGAAGTAGAGGGG + Intronic
1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG + Exonic
1081216304 11:40403220-40403242 ACTCTGCACCACAAGATGAGTGG + Intronic
1083662244 11:64256820-64256842 ACTGTGCCCCAGGAGGAGTGGGG - Intronic
1083930236 11:65838775-65838797 ACTCTGACCCAGAATTAATGTGG + Intronic
1083949347 11:65945526-65945548 ACTCTCTCCCAGAAGGAGATTGG + Exonic
1090208340 11:124897909-124897931 ACTCTGCCCCAGGAGGGAAGCGG + Exonic
1091510744 12:1122922-1122944 GCTCTGCCCCAGGTATAGAGAGG - Intronic
1095091806 12:38114439-38114461 CCTCAGCCCCACAAGTAGATGGG + Intergenic
1095896953 12:47289283-47289305 ACTCTGCTCCAGACATAGGGGGG + Intergenic
1095965542 12:47864721-47864743 ACCCTGACCCAGGAGTAGAAGGG + Intronic
1098639456 12:72821760-72821782 ACTCTGCCAAATAACTAGAGTGG - Intergenic
1098990975 12:77065156-77065178 ACTCCGGCCCGGCAGTAGAGGGG - Intronic
1100180924 12:92085573-92085595 ACTCTACCCCAGAAACAGAAAGG + Intronic
1101662969 12:106783076-106783098 ACTCTGTAGCTGAAGTAGAGGGG - Intronic
1101763831 12:107681095-107681117 TTTCTGCCCCAGAAGTGAAGTGG + Intergenic
1102586009 12:113923516-113923538 ACTTTTCCCCAGAAGTACTGGGG - Intronic
1103681961 12:122701374-122701396 CCTCTGCCCCACAGTTAGAGGGG - Exonic
1103683709 12:122714837-122714859 CCTCTGCCCCACGGGTAGAGGGG - Exonic
1104673300 12:130695222-130695244 ACTCAGGCTCAGAAGAAGAGGGG - Intronic
1105209423 13:18249089-18249111 TCTGTGGCCCAGAAGGAGAGGGG + Intergenic
1118335036 14:64846222-64846244 ACTCTGCCCCAGAAGTAGAGTGG + Intronic
1121141127 14:91543479-91543501 ACACTACCCCAGCAGTAGAAGGG + Intergenic
1125468077 15:39974829-39974851 ACTCTGACACAGAAGCACAGAGG - Intronic
1126415639 15:48415160-48415182 TCCCTGCCCCAGGAGAAGAGTGG + Intronic
1127082116 15:55391236-55391258 CCTCAGCCCCATAAGTAGATGGG + Intronic
1128210810 15:65900755-65900777 AATTTAGCCCAGAAGTAGAGAGG + Intronic
1129362885 15:75035399-75035421 AATCTGCCCCAGACGTAGCCTGG + Intronic
1129687383 15:77694576-77694598 CCTCTGCCCCAAAACTTGAGAGG + Intronic
1131691385 15:94831451-94831473 AAGATGCCCCAGAAGTAGAATGG + Intergenic
1133812180 16:9169166-9169188 CCTCTGTCCCAGAAGCAGACTGG - Intergenic
1134071718 16:11264359-11264381 ACACTGCCCAGGAAGTAGGGAGG + Intronic
1136051369 16:27652770-27652792 ACTCTGCCCCTGCAGTACAGTGG - Intronic
1136986711 16:35113089-35113111 CTTCTCCCCCAGTAGTAGAGAGG - Intergenic
1137041527 16:35617071-35617093 ACTCTGCCAAATAACTAGAGTGG - Intergenic
1138288247 16:55826085-55826107 ATTCTGCCCCAGAAGATGCGGGG + Intronic
1139323904 16:66136791-66136813 ACTCTGCCCCAGCTGTAAATAGG + Intergenic
1140597328 16:76431669-76431691 ACTCTGTCTCAAAAGTAAAGGGG + Intronic
1142741162 17:1932717-1932739 ACTCTGCCGTGGAAGTGGAGGGG - Intergenic
1143586845 17:7854698-7854720 TCTCTGCCCCAGGGGCAGAGGGG + Exonic
1146106330 17:30040434-30040456 ACTCTGCCAAATAATTAGAGTGG + Intronic
1147400237 17:40176660-40176682 ATGCTGCCCCAGAAGGAGTGTGG - Intergenic
1147574860 17:41593284-41593306 AGACTGCCCCAGAAGTAGTGGGG + Intergenic
1147745371 17:42691456-42691478 ACTGGGCCTCAGAAGTGGAGCGG - Exonic
1148030922 17:44620298-44620320 ACTCAGCCCCCGAAGTAGCTGGG - Intergenic
1155905647 18:31447886-31447908 GCTCTTCCCCAGAACTACAGGGG + Exonic
1156726719 18:40137347-40137369 ACTCTGCCTCTGAAATAGTGAGG - Intergenic
1157493369 18:48138963-48138985 TATCTGCCCCACAAGAAGAGAGG - Intronic
1160097602 18:75889707-75889729 AGTCTGCCAAAGAAGGAGAGAGG - Intergenic
1161149624 19:2701229-2701251 CATCTCCCCCAAAAGTAGAGGGG + Intronic
1161744541 19:6047678-6047700 ACTGTCCCACAGAAGGAGAGAGG + Intronic
1162281980 19:9706069-9706091 ACTCTGCCAAATAACTAGAGCGG + Intergenic
1163934448 19:20429596-20429618 ACTCTGCCGAATAACTAGAGTGG - Intergenic
1165080938 19:33305631-33305653 ACTCTGGCCAAGACGGAGAGGGG + Intergenic
1167003851 19:46762595-46762617 CCTCTGGCCCAGAAGTCCAGGGG + Intronic
1167935376 19:52902056-52902078 ACTCTGCCGAATAACTAGAGTGG - Intergenic
924972038 2:137042-137064 AAGCTGCCACAGAAGTGGAGAGG - Intergenic
925225759 2:2182986-2183008 ACTCTGCCACAGAGGTGGGGAGG + Intronic
928335447 2:30394267-30394289 ACTCAGGGCCAGAGGTAGAGTGG - Intergenic
930107502 2:47651532-47651554 ACCCTGCCCCAGAGGAAGAAGGG - Intergenic
932840930 2:75081576-75081598 ACTCTGCCCCCAACCTAGAGGGG - Intronic
932880547 2:75497733-75497755 CCTCAGCCCCAGAAGTAGCTGGG - Intronic
935407543 2:102724814-102724836 GCTCTGCCTCAAAAGTAGTGTGG + Intronic
939175273 2:138740862-138740884 ACTCTGCCACAGAAATATGGGGG + Intronic
940779038 2:157913906-157913928 CCTCTGCCCCCCAAGTAGATGGG - Intronic
942565574 2:177263237-177263259 TCTCTGCCCCTGCAGAAGAGGGG + Intronic
943024933 2:182616342-182616364 AATCTGCCTCAGAAGGTGAGAGG + Intergenic
943665400 2:190603551-190603573 ACACTGCCCCAGGAGTAGGATGG - Intergenic
944521302 2:200570792-200570814 CCTCAGCCCCAACAGTAGAGTGG - Intronic
944996467 2:205300482-205300504 ACACTGCCCCATTAGAAGAGGGG + Intronic
945146047 2:206739298-206739320 ACTCAGCCCCTGAAGTAGCTGGG - Intronic
948228747 2:236334383-236334405 TCTCTGGCCCAGAAGTGCAGTGG + Intronic
1169224153 20:3846189-3846211 CCTCTGCCCCAGAAGGGGAAGGG + Intergenic
1170734609 20:19003984-19004006 CCTCTGCACCATCAGTAGAGAGG - Intergenic
1173962817 20:47088318-47088340 TCTCTGCCCCAGAGGTAAACGGG - Intronic
1174253274 20:49235117-49235139 TCTCTGCCCCAGAAGGATGGTGG - Intronic
1174468814 20:50739844-50739866 AGACTGGCCTAGAAGTAGAGGGG + Intronic
1177589520 21:23144669-23144691 CCTCTGCCCCACAAGTAGATGGG - Intergenic
1177645538 21:23896079-23896101 CCTCTGCCCCAGGAGTACAGTGG + Intergenic
1179068990 21:38054191-38054213 TCTCTGCCTCAGCAGAAGAGTGG - Exonic
1180613698 22:17113914-17113936 GCTCTGCCCCAGAAGCAGGCTGG - Exonic
1180997368 22:19972159-19972181 GCTCTGACCCACAAGTGGAGGGG - Intronic
1181964546 22:26647471-26647493 AATCAGCCCCAGAAGGAGCGGGG + Intergenic
1182776159 22:32832734-32832756 ACTCTGTCTCAGAAAAAGAGAGG - Intronic
1184051706 22:42011171-42011193 ACTCTTCCCCAAAATTAAAGAGG - Intronic
949554608 3:5142294-5142316 ACTCTGCCCCCTATCTAGAGAGG + Intronic
951299403 3:20975403-20975425 ACTCTGCCCCAAGACTTGAGTGG - Intergenic
951981656 3:28573758-28573780 ACTGTCCCCCAAAAATAGAGGGG + Intergenic
953288498 3:41637236-41637258 ATTTTGACTCAGAAGTAGAGAGG - Intronic
954416454 3:50395743-50395765 ACTCTGCCCCAGGAGAGCAGAGG - Intronic
954932830 3:54298773-54298795 ACTCTGGCCTAGAAGGAAAGTGG + Intronic
955875771 3:63488979-63489001 ACACTTCCCCAAAAGGAGAGTGG + Intronic
956612315 3:71136420-71136442 ACAATGCCCCAGAAGTTGAAAGG - Intronic
956713068 3:72055506-72055528 ACTCCACCCCTGAAGGAGAGAGG + Intergenic
959917094 3:111828181-111828203 ACTCTGCCCCAGAAGAGAAGGGG - Intronic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
972834530 4:42853678-42853700 ACTCTGCCCCAGAGACAGAGGGG - Intergenic
973888027 4:55342348-55342370 ACTCTGCCAAATAATTAGAGTGG + Intergenic
974023367 4:56711249-56711271 ACTTTGCTCCAGAATTGGAGTGG - Intergenic
974949755 4:68573681-68573703 ACTCTGCCAAATAACTAGAGTGG - Intronic
974988043 4:69053830-69053852 ACTCTGCTGAATAAGTAGAGTGG + Intronic
976648046 4:87405983-87406005 TCTCTACCCCATAAGTTGAGAGG + Intergenic
976990251 4:91356604-91356626 ACTCTGCCAAATAACTAGAGTGG - Intronic
979608885 4:122669700-122669722 ACTGTGCCACTGAAGTAAAGTGG - Intergenic
982533512 4:156578366-156578388 ACGCTGCCCCAGCAGCACAGGGG + Intergenic
983549097 4:168996164-168996186 ACTCTGCACTAAAAGTAAAGTGG + Intronic
987952006 5:24687614-24687636 ACTTTGCTCCAAAATTAGAGTGG + Intergenic
988401164 5:30762315-30762337 ACTCAGCCTCACAAGTAGTGGGG - Intergenic
989557671 5:42816285-42816307 ACTCTGCCGAATAACTAGAGTGG + Intronic
989952364 5:50314947-50314969 ACGCTTCTTCAGAAGTAGAGGGG + Intergenic
990327159 5:54689898-54689920 ACTCTTCCCCACTAGAAGAGTGG - Intergenic
991515428 5:67429632-67429654 ACAATGCCCCAGAAGAAGAGAGG - Intergenic
991655387 5:68898940-68898962 TCTCTGGCACATAAGTAGAGGGG + Intergenic
992989609 5:82270746-82270768 ACTCTGCCTAATAACTAGAGTGG - Intronic
997594732 5:135099365-135099387 TCTCAGCCTCAGAAGTAGAATGG + Intronic
999190054 5:149740477-149740499 CACCTGCCCCACAAGTAGAGAGG - Intronic
1000604812 5:163316531-163316553 ACTCTGCCAAATAACTAGAGTGG - Intergenic
1002929789 6:1625088-1625110 ACGCTGCCGCCGAGGTAGAGGGG - Intronic
1005991552 6:30905990-30906012 ACCCTGTCCCAAAAGGAGAGGGG - Intergenic
1009333290 6:62453210-62453232 ACTCTCCCCCAGAAATAAAAAGG - Intergenic
1010317842 6:74471122-74471144 ACTCTGCCAAATAACTAGAGTGG + Intergenic
1015172008 6:130264471-130264493 ACTCTGCCAAATAACTAGAGTGG + Intronic
1019671878 7:2284340-2284362 ACCCCGCCCCCGAAGTAGAATGG + Intronic
1019747869 7:2710568-2710590 ACTCTACCCCAGAAGGAAGGAGG - Intronic
1022220031 7:28305180-28305202 GTTCTGCCCCAGAAGAACAGGGG - Intronic
1025114605 7:56246776-56246798 ACTGAGCCCCAGAAATACAGTGG - Intergenic
1026198900 7:68196862-68196884 ACTGAGCCCCAGAAATACAGTGG - Intergenic
1026258210 7:68731379-68731401 ACTCTGTCCCCAAAGAAGAGAGG - Intergenic
1026405384 7:70060423-70060445 ACTCTACCCCAGAAGTCCTGTGG + Intronic
1027384272 7:77644891-77644913 ACTCTGGACCTGAATTAGAGTGG + Intergenic
1028948511 7:96607844-96607866 AAGGTGCCCCAGAAGTAGACTGG - Intronic
1033137379 7:138796668-138796690 ACTCTGCCTGAGAGGTATAGGGG - Intronic
1033213822 7:139480087-139480109 ACACAGCCCCAGTAGTGGAGCGG + Intronic
1033539621 7:142344902-142344924 CCTCTGTCCCTGAAGTGGAGGGG - Intergenic
1035617443 8:1012692-1012714 ACACTGCCGCTGAAGTAGGGGGG - Intergenic
1039344140 8:36685236-36685258 CCTCTTTCCCAGAAGTAGAAAGG - Intergenic
1040013500 8:42681767-42681789 AAGCTGCCCCAGAAGCAGATGGG - Intergenic
1043812959 8:84765379-84765401 ACCCTGCCCCAGCAGCAGACAGG - Intronic
1044326551 8:90865298-90865320 AATTTGCCCCAGAATTAGAGAGG + Intronic
1045906843 8:107355830-107355852 AGTGTGCTCCAGAAGTAGAAAGG - Intronic
1045985506 8:108245351-108245373 CCTCAGCCCCAGAAGTAGCTGGG - Intronic
1049005570 8:139853429-139853451 ACTCTGCCCCACAGGTGGAAGGG + Intronic
1049060566 8:140273190-140273212 AGTGTGGCCCAGAAGTTGAGAGG - Intronic
1049579131 8:143403153-143403175 TCTCTGCCCCAGGGGTGGAGAGG - Intergenic
1050500594 9:6294046-6294068 TCCCTTCCCCAGAAGTAGTGGGG + Intergenic
1056932970 9:90893869-90893891 ACTCTGGCCCGAAAGCAGAGTGG + Intronic
1058959561 9:109979916-109979938 ACTCTCCCCCAGACGCAGACAGG + Intronic
1060602027 9:124884741-124884763 ACACTGCCCCAAAAGTACATTGG + Intronic
1061272390 9:129550615-129550637 TCTCTGCTCCAGAAGGAAAGGGG - Intergenic
1061727918 9:132591170-132591192 ACCCTGCCCCCAAACTAGAGGGG - Intergenic
1188063844 X:25633408-25633430 ACTTTGCCCCTTAAGCAGAGGGG + Intergenic
1190218155 X:48493617-48493639 AAGCTGGCCCAGATGTAGAGTGG + Intergenic
1198149258 X:133892231-133892253 GCTCTGCTCCAGAAGTAAAATGG - Intronic
1199335601 X:146615776-146615798 ACTCTAGCACAGAAGGAGAGGGG - Intergenic