ID: 1118337116

View in Genome Browser
Species Human (GRCh38)
Location 14:64863036-64863058
Sequence CAGTAGGAATGGAAGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 754}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118337116_1118337127 21 Left 1118337116 14:64863036-64863058 CCACCTCCCTTCCATTCCTACTG 0: 1
1: 0
2: 4
3: 76
4: 754
Right 1118337127 14:64863080-64863102 GTCCTTTGTTATATTTCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 230
1118337116_1118337128 22 Left 1118337116 14:64863036-64863058 CCACCTCCCTTCCATTCCTACTG 0: 1
1: 0
2: 4
3: 76
4: 754
Right 1118337128 14:64863081-64863103 TCCTTTGTTATATTTCTGCAGGG 0: 1
1: 0
2: 0
3: 28
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118337116 Original CRISPR CAGTAGGAATGGAAGGGAGG TGG (reversed) Intronic
900853633 1:5163276-5163298 CAGTATGAGTGGAACGGAGCCGG - Intergenic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
901130928 1:6962371-6962393 GAGGGGGAGTGGAAGGGAGGAGG - Intronic
901199150 1:7456994-7457016 GAGGAAGAATGGGAGGGAGGAGG - Intronic
901336281 1:8451847-8451869 CAGTAGCATTGGAAGAGTGGAGG - Intronic
901658359 1:10783444-10783466 CAGAAGGAAAGGATGTGAGGGGG + Intronic
902113398 1:14101511-14101533 GAGTAGGGATTGAAGGGAGAGGG + Intergenic
903021772 1:20400018-20400040 CTGTAGGAAGGCAGGGGAGGAGG - Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
904212907 1:28897563-28897585 AGGTAGGAAGGGAAGGGAAGCGG + Intronic
904288316 1:29468013-29468035 GAGTGGGAAAGGATGGGAGGAGG - Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904372157 1:30056121-30056143 CAGTGGGAATGGAATGGACGTGG - Intergenic
904576754 1:31509714-31509736 GAGTTGGGATGGCAGGGAGGAGG + Intergenic
904676533 1:32202107-32202129 CAGAAGGGAAGGAAAGGAGGAGG + Intronic
905409406 1:37757937-37757959 CTCTAGGACTGGAAGGGAGGAGG - Intronic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905732545 1:40306550-40306572 CAGGAGGTATGGAATGGAGATGG + Intronic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
906560370 1:46752251-46752273 GATTGGGAAGGGAAGGGAGGAGG + Intergenic
906682944 1:47743108-47743130 CAGTGGCGATGGCAGGGAGGTGG + Intergenic
906708726 1:47913681-47913703 AGGTAGGAAAGGAAGGGAAGAGG - Intronic
906779474 1:48559790-48559812 AAGCAGGAATGTAGGGGAGGGGG - Intronic
907268779 1:53278274-53278296 CAGGAGGGAGGGAAGTGAGGAGG - Intronic
907437427 1:54458757-54458779 CAGGAGGGAGGGAAGGAAGGAGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908371138 1:63478931-63478953 AAGGACAAATGGAAGGGAGGTGG + Intronic
909069717 1:70980083-70980105 AAGAAGAACTGGAAGGGAGGCGG + Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909692067 1:78420727-78420749 AAGGAGGGAAGGAAGGGAGGAGG - Intronic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910262756 1:85307783-85307805 CAGTAGGCATGGAAGGCAAGGGG - Intergenic
910454909 1:87387238-87387260 GAGTAGGAATGGAACAAAGGAGG - Intergenic
910636016 1:89408750-89408772 TAGTAGGAGTGGAGAGGAGGAGG - Intergenic
911433825 1:97829715-97829737 CAGTAGGATTGGCAAAGAGGAGG - Intronic
912177806 1:107182204-107182226 CATTAGGAATGGGAAGGAGGAGG + Intronic
912462917 1:109848762-109848784 AAGTATGAATGGATGGGTGGAGG + Intergenic
912548708 1:110470134-110470156 AAGAAGGAAGGGAAGGGAGGAGG - Intergenic
912605582 1:110985582-110985604 CAGCAGGTATGGAAATGAGGAGG + Intergenic
913169813 1:116221943-116221965 CAGAAGCAATGCCAGGGAGGAGG + Intergenic
913194774 1:116446602-116446624 AAATAGGATTGGAAGGCAGGGGG - Intergenic
913441796 1:118906421-118906443 CAGAAGGAAAAGAAGGGACGAGG - Intronic
914783625 1:150808371-150808393 GAGAAGGAAGGGTAGGGAGGAGG + Intergenic
915016348 1:152737650-152737672 CAGCAGGAACGGACTGGAGGTGG - Intronic
915029795 1:152868299-152868321 CAGTAGGAATGGAGGTGGTGAGG - Intergenic
915144220 1:153785295-153785317 CTGTAGGAAAGGGAGGGATGCGG - Intergenic
915294257 1:154909071-154909093 CAGGAGGAAGGGATGGGAGGAGG + Intergenic
915516562 1:156416165-156416187 CAATAGCAAAGGAAGGGAGGTGG + Intronic
915525711 1:156475120-156475142 CAGTGGGCATGGAAGAGAAGGGG + Exonic
915921180 1:159976736-159976758 CAATGGGAATGGTTGGGAGGAGG + Intergenic
916295371 1:163213435-163213457 CAGAAAGAATGGAGAGGAGGGGG - Intronic
917265002 1:173211444-173211466 CAATAGGAATGGCAAAGAGGAGG - Intergenic
917298815 1:173550906-173550928 GAGAAGGAAGGGAAGGGAAGAGG + Intronic
917439568 1:175055157-175055179 CAGTAGGAAAGGAAAGTAAGTGG + Intergenic
917596426 1:176533580-176533602 CTGTAGAAGTGGCAGGGAGGAGG - Intronic
919344853 1:196362279-196362301 CAGGAGGAAAGCAAGGAAGGAGG - Intronic
919838766 1:201594333-201594355 CAGGAGAAAGGGAGGGGAGGAGG + Intergenic
919846103 1:201643198-201643220 GAGAAGGAAGGGAAGGAAGGAGG - Intronic
919848779 1:201658475-201658497 AACTAGAAAAGGAAGGGAGGAGG + Intronic
919880639 1:201898441-201898463 CAGTAGGGAGGGAGGTGAGGTGG - Intronic
919924809 1:202186729-202186751 CTGAAGGAGTGGGAGGGAGGTGG + Intergenic
920121269 1:203660484-203660506 CAGTAAGAAGAGAACGGAGGTGG + Intronic
920207704 1:204304816-204304838 GGGCAGGTATGGAAGGGAGGGGG + Intronic
920634199 1:207683135-207683157 CAGTAGGAAAGAAAGGGGCGGGG - Intronic
920922225 1:210307521-210307543 GAGTAGAAACAGAAGGGAGGAGG - Intergenic
921186622 1:212675702-212675724 AAGAAGGAAGGGAAGGGAAGGGG + Intergenic
921432487 1:215081695-215081717 CAGTTGGGATGGGAGGGTGGAGG + Intronic
921668510 1:217901217-217901239 CAGAAGGACTGGAAGTGGGGAGG + Intergenic
921948421 1:220905013-220905035 CCCTAGGAGAGGAAGGGAGGGGG - Intergenic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
923001878 1:230012879-230012901 CTATAGGAATGGCAGGGAGCAGG + Intergenic
923687007 1:236160478-236160500 CAGGAGGCAGGGAAGGGTGGAGG - Intronic
924257272 1:242194870-242194892 CAGGAGGAAAGGGAGGGAAGCGG + Intronic
924793503 1:247274858-247274880 CTGTTGCAATGGAAAGGAGGGGG + Intergenic
1062943994 10:1446049-1446071 GACGAGGAATGGAAGGGAGGGGG + Intronic
1063687803 10:8255169-8255191 AGGAAGGAAAGGAAGGGAGGAGG - Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1063929009 10:11010395-11010417 CAGTTGGAAAGGAAGAGAGAAGG - Intronic
1063967843 10:11360588-11360610 AAGGAAGGATGGAAGGGAGGCGG + Intergenic
1064112836 10:12553376-12553398 CAGGAGGTAGGGAAGGGAGGAGG - Intronic
1064526406 10:16260727-16260749 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1064952241 10:20865866-20865888 CAGTAGGAATGAAAATGAAGTGG - Intronic
1065247111 10:23769384-23769406 CAGGAGCAATTGAGGGGAGGGGG + Intronic
1065708278 10:28491252-28491274 GTGTAGGACTGGAAGGGAGGAGG + Intergenic
1065958725 10:30716185-30716207 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1068232416 10:54186102-54186124 TAGTAGGAAAGAAAGGCAGGTGG + Intronic
1068589286 10:58837264-58837286 CAGCAGGAAGGGAAAGGAAGAGG + Intergenic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1069323547 10:67203595-67203617 GAGTTGGAATGGAAAGGAGAGGG - Intronic
1070042462 10:72795062-72795084 AAATAGAAATGGAAGAGAGGTGG - Intronic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070711034 10:78683365-78683387 TGGGAGGAATGGAAGGGAAGGGG + Intergenic
1070743646 10:78919388-78919410 AAGTGGGGATGGAAGGGATGTGG + Intergenic
1071316542 10:84406249-84406271 CAGAAGGTATGGATGGGAGGAGG + Intronic
1071444866 10:85736169-85736191 CAGGAAGAAAGGAAGGAAGGAGG + Intronic
1071588323 10:86846851-86846873 CAGTCTGAATGGAAGAGAGTGGG - Intronic
1072510660 10:96120953-96120975 CGGCAGGGATGGCAGGGAGGTGG - Intergenic
1072649956 10:97287361-97287383 AACCAGAAATGGAAGGGAGGGGG + Intronic
1072904896 10:99443970-99443992 GAATAGGAATGGAAGGGAAAGGG + Intergenic
1073070021 10:100787432-100787454 TGGAAAGAATGGAAGGGAGGTGG + Intronic
1073092167 10:100951399-100951421 CAGTAGAAATGGCAGTCAGGTGG + Intronic
1073565794 10:104534684-104534706 GAAGAGGAAGGGAAGGGAGGAGG - Intergenic
1073625343 10:105091074-105091096 CAGGAGGGAGGGAAGGAAGGAGG - Intronic
1073625490 10:105091553-105091575 AAGGAGGAAGGGAAGGAAGGAGG - Intronic
1074604689 10:114949741-114949763 CAGAGGGAATGGAAAGGAAGGGG + Intronic
1075087473 10:119423139-119423161 AAGAAGGAAGGGAAGGGAGGTGG - Intronic
1075157215 10:119988368-119988390 CAGTAGGAATAGAAGGAATGGGG + Intergenic
1075513898 10:123094370-123094392 GAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1075902082 10:126051359-126051381 AAGTAGGAAGGGAAGGAGGGAGG - Intronic
1076136476 10:128048689-128048711 TAGCAGGAACGGAAGGGAGGAGG + Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076571950 10:131438886-131438908 GAGGAGGGAAGGAAGGGAGGAGG - Intergenic
1076583376 10:131529949-131529971 CAGGAGGAAGGGGAGGGATGGGG + Intergenic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077885559 11:6385055-6385077 CAGTAGGAAAAGGAGGGAGGAGG - Intergenic
1078572715 11:12473443-12473465 CGGAATGAATGGAAGCGAGGTGG - Intronic
1079683823 11:23331740-23331762 CAGTGGGACTGGCAGGTAGGTGG + Intergenic
1080543799 11:33296073-33296095 CTGAAAGAAAGGAAGGGAGGGGG - Intronic
1080574745 11:33587936-33587958 CAGAAGGAAAGGAAGGGCTGTGG + Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1082009805 11:47442273-47442295 CAGATGGATTGGAAGGGAGTGGG + Intronic
1082973235 11:59045472-59045494 GGGTAGGAATGGAGGAGAGGAGG - Intergenic
1082977631 11:59089036-59089058 GGGTAGGAATGGAGGAGAGGAGG - Intergenic
1083327323 11:61879417-61879439 CAGTAGGAAAGCAAAGAAGGTGG + Exonic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083901287 11:65644756-65644778 AGGTAGGAAGGGATGGGAGGAGG - Intronic
1085119458 11:73957853-73957875 AAGTATGAAGGGAAGGGAGCAGG + Intronic
1085312115 11:75522874-75522896 CAGCAGGAAGCCAAGGGAGGGGG + Intronic
1085404543 11:76254225-76254247 AAGGAGGAATGGAAGGGCTGAGG + Intergenic
1085474355 11:76780633-76780655 TAGAAGTAAGGGAAGGGAGGTGG - Intergenic
1085591165 11:77762403-77762425 CACTAGGGATGGAAAGGAGGGGG - Intronic
1085721112 11:78913206-78913228 AAGCAGGAAGGGAAGGAAGGAGG - Intronic
1085741216 11:79079924-79079946 CAGTAGGGATGGGACTGAGGAGG - Intronic
1085750324 11:79155688-79155710 AAGGAGGAAAGGAGGGGAGGGGG - Intronic
1085970771 11:81587953-81587975 AAGGAAGAAAGGAAGGGAGGAGG + Intergenic
1086888416 11:92227628-92227650 GAGAAGGAAAGGAAGGGAGGAGG + Intergenic
1087527169 11:99330215-99330237 GAGAAGGAAGGGAAGGAAGGAGG + Intronic
1087678895 11:101195718-101195740 TAGTAGGAATGAAAGAAAGGAGG - Intergenic
1087699617 11:101420899-101420921 CAGGAGGAAGGGGAGAGAGGTGG + Intergenic
1087721951 11:101676257-101676279 CAGTAGGTATGGAAGAGGAGAGG - Intronic
1088339306 11:108745071-108745093 AAGAAGGAAAGGAAGGGAAGGGG - Intronic
1088438433 11:109841392-109841414 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1088484553 11:110328366-110328388 CACAAGGAAGGGAAGGGAAGGGG - Intergenic
1088524309 11:110736325-110736347 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic
1089128567 11:116194360-116194382 GAGAAGGCAAGGAAGGGAGGAGG - Intergenic
1089196268 11:116695618-116695640 AAGGAGGAAAGGAAGGGAGGAGG - Intergenic
1089641914 11:119853352-119853374 GAGGAGGAATGGGTGGGAGGTGG - Intergenic
1090244650 11:125207224-125207246 AGGGAGGAAAGGAAGGGAGGAGG - Intronic
1090500403 11:127255370-127255392 CAGAAGGAGTGAGAGGGAGGAGG + Intergenic
1090556556 11:127882904-127882926 AAGTAGGAAGGGATGGGAGGCGG + Intergenic
1090601724 11:128379216-128379238 AAATAGGAATGGCAGGGAGAGGG + Intergenic
1090626390 11:128612451-128612473 AAGGAAGAAGGGAAGGGAGGGGG - Intergenic
1090912309 11:131132023-131132045 AGGTAGGAAAGGAAGAGAGGGGG - Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091453554 12:588230-588252 CAGAAGGGAGGGAAGGGAGGAGG + Intronic
1091749563 12:3014035-3014057 CAGGAGGAATGGAACTGAGTGGG - Intronic
1091887668 12:4028417-4028439 CAGGAGGAAAGGAAAAGAGGAGG - Intergenic
1092746338 12:11675864-11675886 GAGAAGGAAAGGAAGGGAGAGGG + Intronic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1093215591 12:16357950-16357972 CAAAAGTAATGGCAGGGAGGAGG + Intronic
1093945229 12:25100201-25100223 AAGTTGGAAAGGAAGGAAGGAGG + Intronic
1094650104 12:32367913-32367935 CAGTAGGAATACAAGAGAGCTGG + Intronic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095698856 12:45170570-45170592 GAGAAAGAATGGAAGGGACGGGG + Intergenic
1095992659 12:48047322-48047344 CAGAAGGAATGGTAGGTAGAAGG - Intronic
1096045597 12:48559579-48559601 GAGAAGGAAGGGAAGGGAGTTGG - Intergenic
1096196075 12:49649602-49649624 CAGAAGGACTGGAAGGGCAGGGG + Intronic
1096539948 12:52301535-52301557 AGGTTGGAATGGAAGGGAAGGGG - Intronic
1097191792 12:57222821-57222843 GAGGAGGGATGGATGGGAGGGGG + Intronic
1097626426 12:62007080-62007102 CAGGAAGAATGGTAGAGAGGTGG - Intronic
1097627627 12:62020324-62020346 CAGTAGAAATGAAAGGATGGGGG - Intronic
1097819162 12:64110226-64110248 TGGTAGGAATGGTATGGAGGGGG - Intronic
1098169627 12:67733750-67733772 GAGAAGAAATGGGAGGGAGGAGG - Intergenic
1098554208 12:71800199-71800221 AAGCAGGAATGGGAGGGAGAAGG - Exonic
1099648295 12:85389636-85389658 CAGTAAGAATAGAAAGGAAGAGG - Intergenic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1100594084 12:96056466-96056488 CAGGAGGATTGGGAGGGAAGGGG - Intergenic
1100749666 12:97683678-97683700 CAGAAAGAAAGAAAGGGAGGGGG + Intergenic
1101345587 12:103883183-103883205 GACAAGGAAGGGAAGGGAGGTGG + Intergenic
1102553717 12:113711822-113711844 CTGAAGGAAGGAAAGGGAGGAGG - Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102759845 12:115375603-115375625 GAGAAGAAATGAAAGGGAGGGGG + Intergenic
1102913610 12:116737320-116737342 GAGGAGGAAGGGAAGGAAGGAGG + Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1104139077 12:125969287-125969309 AAGGAGGAAAGGAAGGAAGGAGG - Intergenic
1104463205 12:128971414-128971436 GAGGAGGAGAGGAAGGGAGGAGG - Intronic
1104738645 12:131156226-131156248 AAGGAGGAAGGGAAGGGAGGAGG - Intergenic
1105244802 13:18639794-18639816 CACTAAGACTGGAAGTGAGGGGG + Intergenic
1106297089 13:28424343-28424365 CATTAGGAATAAAAGAGAGGAGG - Intronic
1106783555 13:33085217-33085239 AAGGAGGAAGGGAAGGGAAGGGG + Intergenic
1107039668 13:35935432-35935454 CAGTAGCATTGGAAAGGAGGGGG + Intronic
1107338916 13:39385397-39385419 CAGTGGGAATGGAAAAGAGCTGG + Intronic
1107662336 13:42651529-42651551 CAGAAGGAGGGGAAGGGAGAGGG - Intergenic
1108252131 13:48577919-48577941 AAGGAGGAAGGGAAGGGAGAAGG - Intergenic
1108359352 13:49654969-49654991 CAGTAGAAAGGGAAGAGAGAAGG + Intergenic
1108723138 13:53152229-53152251 GAGTGGGGATGGAAAGGAGGGGG + Intergenic
1110098900 13:71570719-71570741 GTTTAGGAATGGAAAGGAGGGGG - Intronic
1110306560 13:73994475-73994497 CAGTATGAATGAAAGTGTGGTGG - Intronic
1111280282 13:86014153-86014175 CAGTAGCAATGGAAAGATGGAGG + Intergenic
1111509006 13:89235904-89235926 CAGCAGAAAAGCAAGGGAGGGGG - Intergenic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1112292862 13:98160342-98160364 CAGTAGCAATGCAAGGAAAGGGG - Intronic
1113346809 13:109486190-109486212 CAGGAGGAATAGAAAGCAGGGGG - Intergenic
1113949279 13:114062377-114062399 CAGTAACAAGGGTAGGGAGGTGG + Intronic
1114723565 14:24909535-24909557 CTGTAGGAAGGCAAGGCAGGTGG + Intronic
1115491202 14:33960053-33960075 CAGGAGGAATACCAGGGAGGGGG - Intronic
1115587536 14:34829589-34829611 TTGTAGGAATGGTAGGGAAGTGG - Intronic
1116161021 14:41266577-41266599 CATTAAATATGGAAGGGAGGTGG - Intergenic
1116948318 14:50856658-50856680 CAGGAGGAATGGAAAAGAGGAGG - Intergenic
1116988452 14:51246533-51246555 CATTGGGAATGGGAAGGAGGAGG + Intronic
1117023703 14:51598276-51598298 CTGCAGGAAGGGAATGGAGGAGG - Intronic
1117505988 14:56403556-56403578 AAGCAGGAAGGGAAGGAAGGAGG - Intergenic
1117950316 14:61076183-61076205 CAGTAGGAATCAGAGGGAGTGGG + Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119673843 14:76539191-76539213 CAAAGGGAAGGGAAGGGAGGGGG - Intergenic
1119728298 14:76935591-76935613 AAGTGGGAAGGGAAGGGAGGGGG - Intergenic
1120966436 14:90171653-90171675 CAGGAAGAATGGAAGTGGGGAGG + Intronic
1121442045 14:93955575-93955597 CAGCTGAAGTGGAAGGGAGGAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121637726 14:95465177-95465199 GAGGAGGAAGGGAGGGGAGGAGG + Intronic
1121661016 14:95635177-95635199 CAATAGGAAAGGAGGAGAGGTGG - Intergenic
1122506416 14:102234594-102234616 CATAGTGAATGGAAGGGAGGGGG - Intronic
1122622201 14:103065788-103065810 CATTGGGAAGGGGAGGGAGGAGG - Intergenic
1122870491 14:104635983-104636005 CAGTTGGAATGGAAGGAGGCGGG - Intergenic
1123757257 15:23406644-23406666 CAGCAGGCAAGGAAGGAAGGAGG - Intergenic
1124485750 15:30114253-30114275 CTCTATGAACGGAAGGGAGGAGG - Intergenic
1124517825 15:30383015-30383037 CTCTATGAACGGAAGGGAGGAGG + Intronic
1124540828 15:30583239-30583261 CTCTATGAACGGAAGGGAGGAGG - Intergenic
1124547515 15:30644975-30644997 CTCTATGAACGGAAGGGAGGAGG - Intronic
1124757830 15:32424341-32424363 CTCTATGAACGGAAGGGAGGAGG + Intergenic
1124815634 15:32989252-32989274 CACTGGGGATGGAAGGTAGGTGG + Intronic
1125089650 15:35775283-35775305 GAGTAAGAAAGGAAGGAAGGCGG - Intergenic
1125508034 15:40278247-40278269 CAGTAGGACGGGCAGGGCGGAGG + Intronic
1125582356 15:40795277-40795299 AGGAAGGGATGGAAGGGAGGGGG + Intronic
1125724492 15:41861387-41861409 CAGCAGGAATGGGCAGGAGGGGG - Intronic
1125951031 15:43751575-43751597 CAGCAGGAATGGAACTCAGGTGG - Intronic
1126642500 15:50841992-50842014 AAGAGGGAAGGGAAGGGAGGGGG - Intergenic
1127310005 15:57744116-57744138 CAGTAGGAATATTAGGGAGATGG - Intronic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1127507519 15:59610766-59610788 AAGGAGGAAAGGAAGGAAGGAGG - Intronic
1127692803 15:61414456-61414478 AAGTTGGAATGGAAGGGTGAGGG + Intergenic
1128124942 15:65185356-65185378 GAGAAGGAGGGGAAGGGAGGGGG - Intergenic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1128898599 15:71398505-71398527 CAGAAGGAGTGAAAGGGAGGAGG + Intronic
1128915922 15:71562374-71562396 TGGTAGGAAGGGAAGGGAAGGGG + Intronic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1131289052 15:91089210-91089232 GAGTGGGAATGGAAATGAGGAGG + Intergenic
1131316534 15:91343281-91343303 CATTAGCAATGGAAGGGTGGGGG + Intergenic
1131689303 15:94809372-94809394 GAGGAGGAATGGAAATGAGGAGG + Intergenic
1132209787 15:100011385-100011407 CAGAAGGGAGGGAAGGAAGGAGG + Intronic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133388762 16:5392126-5392148 CAGGGGGAAAGGATGGGAGGAGG + Intergenic
1133787219 16:8982903-8982925 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1134288873 16:12887240-12887262 CAGGAGGAAAGGACGGGAAGGGG - Intergenic
1135030719 16:19036158-19036180 CAGGAGAAATGGGAGTGAGGAGG + Intronic
1135264375 16:21009944-21009966 AAGAAGGAAGGGAAGGGAAGAGG + Intronic
1135633581 16:24055356-24055378 CACTAGGGAAGGAAGGGAGATGG + Intronic
1137390604 16:48078272-48078294 CAGTAGGGAGGGAAGGCAAGGGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137524489 16:49222750-49222772 AAGGAGGGACGGAAGGGAGGGGG - Intergenic
1137911929 16:52386241-52386263 CTGAATGAATGAAAGGGAGGAGG + Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138200072 16:55081916-55081938 CAGAGGGAAGGGAAGGGAAGGGG - Intergenic
1138224729 16:55282843-55282865 CAGAAGGAATGGGAGAGAGGAGG + Intergenic
1138777741 16:59744588-59744610 GAGAAGGAAAGGAAGGAAGGGGG - Intronic
1139131206 16:64148321-64148343 AAGAAGGAAGGGAAGGAAGGAGG - Intergenic
1139968135 16:70756827-70756849 CAGGAGGAAAGGATGGTAGGGGG - Intronic
1140037530 16:71382646-71382668 AAAGGGGAATGGAAGGGAGGTGG + Intronic
1140137552 16:72220977-72220999 CAGCAGGAAAGGAAGGGAAAGGG - Intergenic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140270397 16:73460107-73460129 GAGTGGGAATGGGAGGGAAGGGG - Intergenic
1140379096 16:74470313-74470335 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1140846261 16:78891314-78891336 CAGAAAGGAGGGAAGGGAGGAGG - Intronic
1141588015 16:85047962-85047984 CAGTGGGCAGGGAAGGGTGGCGG + Intronic
1141636004 16:85314199-85314221 GAGAAGGAAAGGAAAGGAGGAGG + Intergenic
1141756777 16:85996730-85996752 CAGTAAGAGAGGAAGGAAGGAGG + Intergenic
1142176604 16:88648168-88648190 CAGTAGGTAGAGAAGGGGGGTGG - Intronic
1143651859 17:8268391-8268413 AAGAAGGAAAGGAAGGAAGGAGG + Intronic
1143701111 17:8660886-8660908 AAGGAGGAAAGGAAGGAAGGAGG - Intergenic
1143869755 17:9949773-9949795 GAGGAGGAGAGGAAGGGAGGAGG - Intronic
1143908216 17:10226727-10226749 CAGGAGGAGAGGAAGGGAGCAGG - Intergenic
1144365724 17:14542146-14542168 GGGAAGGAAGGGAAGGGAGGGGG - Intergenic
1144426659 17:15149248-15149270 CAATAGAAGTGAAAGGGAGGGGG + Intergenic
1144700153 17:17332289-17332311 GAGCAGGAAGGGCAGGGAGGTGG + Intronic
1145274152 17:21420123-21420145 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1145312014 17:21706022-21706044 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1145819903 17:27824253-27824275 CAAGAGGAAGGGAAGGAAGGAGG + Intronic
1145826137 17:27878574-27878596 GTGGAAGAATGGAAGGGAGGGGG - Exonic
1145986198 17:29048587-29048609 CAGTAGGACTCAAAGGGAGAAGG - Intronic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1146536967 17:33661090-33661112 CAGAGGGAGTGGAAGGGAGTCGG - Intronic
1146561056 17:33871094-33871116 CAGGAGGAAGGGAGAGGAGGAGG - Intronic
1146945231 17:36869126-36869148 GAGGAGGAATCGCAGGGAGGAGG + Intergenic
1147375684 17:40021442-40021464 CAGTAAGCCTGGCAGGGAGGAGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147856624 17:43485270-43485292 CCGGAGGGATGGAAGGGAAGGGG + Intronic
1147901580 17:43789779-43789801 TAGAAGGAAGGGAAGGGAAGGGG - Intergenic
1148888292 17:50789281-50789303 CATTAGGAAGGGGAGGGAAGAGG + Intergenic
1149121916 17:53179541-53179563 CAGGAGGAAAGGATGGGAAGGGG - Intergenic
1149560473 17:57604727-57604749 CAGAAGGATAAGAAGGGAGGAGG + Intronic
1149905729 17:60525374-60525396 AAGTAGGAATGGGTGGGGGGAGG + Intronic
1150519605 17:65852361-65852383 AGGAAGGAAGGGAAGGGAGGAGG - Intronic
1151303474 17:73246661-73246683 CACTAGGGATGGAAAGGAGCAGG - Intronic
1151565600 17:74895981-74896003 GAGTGGGAAAGGGAGGGAGGAGG - Intergenic
1151711057 17:75806911-75806933 CAGTGGGAATGGAAGTGAAGAGG + Intronic
1151714518 17:75824711-75824733 CAGTGGGAAGGGCAGGGAGTGGG - Exonic
1154126653 18:11698024-11698046 GAGTGAGAAAGGAAGGGAGGAGG + Intronic
1154444139 18:14420096-14420118 CACTAAGACTGGAAGTGAGGGGG - Intergenic
1155142615 18:23056372-23056394 CAATAGGCAGGGATGGGAGGGGG + Intergenic
1155156092 18:23158889-23158911 CAGAAGGAAAGGAAGGGAAATGG - Intronic
1155243941 18:23889640-23889662 GAAGAGGAAGGGAAGGGAGGAGG + Intronic
1155254394 18:23982131-23982153 GAGGAGGAATGAAAGGAAGGAGG + Intergenic
1155630595 18:27887702-27887724 AAGAAGGGATGGAAGGAAGGAGG - Intergenic
1156442835 18:37208821-37208843 CAGAAGCAATGGGAGTGAGGAGG + Intronic
1156484047 18:37453620-37453642 CAGGAGCAATGGCAAGGAGGTGG + Intronic
1156519287 18:37708066-37708088 AAGTATGACTGGAAGGGAGAAGG - Intergenic
1156736836 18:40270304-40270326 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157147323 18:45177174-45177196 GAGTAGGAATGGCAGGAAGTGGG - Intergenic
1157193543 18:45601000-45601022 AAGTAGGATAGGATGGGAGGGGG + Intronic
1157353675 18:46914375-46914397 CAGAAGAACTGGAAGAGAGGTGG + Intronic
1157520123 18:48339661-48339683 GAGTGGGAATGGGAAGGAGGAGG + Intronic
1157867398 18:51197876-51197898 CGGGAGGAATGAGAGGGAGGTGG - Intronic
1158032180 18:52979302-52979324 TAGGAGGAAAGGAAGGGAGGTGG + Intronic
1158751049 18:60261496-60261518 CAGTAGGAATTCAAAGGAAGAGG + Intergenic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159246763 18:65815848-65815870 GAGTAGGCATAGAAGGGAAGAGG - Intronic
1160112104 18:76043081-76043103 TAGTAGAAATGGAAGTGAGAAGG + Intergenic
1160848973 19:1180623-1180645 CAGGAGGGCTGGCAGGGAGGAGG - Intronic
1161003728 19:1924316-1924338 CAGCAGGAATGAAGGGGAGGAGG - Exonic
1161114070 19:2487267-2487289 CAGTAGGCATGGCACGCAGGTGG + Intergenic
1161207081 19:3046942-3046964 AAGGAGGGAGGGAAGGGAGGAGG - Intronic
1161299901 19:3537583-3537605 CAGGAGGAATGGCTGGGAAGTGG + Intronic
1161427722 19:4213238-4213260 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161922835 19:7279428-7279450 CAGGAGAAATGGAAGAGAAGAGG + Intronic
1162023845 19:7882256-7882278 CAGCAGCTATGGGAGGGAGGTGG + Intergenic
1162788561 19:13051376-13051398 TACTAGGGATGGAAGGGAAGAGG + Intronic
1162968059 19:14165094-14165116 CAGCAGGCTTGGGAGGGAGGGGG + Intronic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163763568 19:19150117-19150139 AAGGAGGGATGGAAGGAAGGAGG + Intronic
1163779661 19:19239735-19239757 GAGGAGGAGTAGAAGGGAGGAGG - Intronic
1163779673 19:19239785-19239807 GAGGAGGAGTGGAAGGGAGGAGG - Intronic
1163779778 19:19240139-19240161 GAGGAGGAGTGAAAGGGAGGAGG - Intronic
1165956886 19:39506703-39506725 AAGGAGGAAGGGAAGAGAGGAGG + Intronic
1167222916 19:48214741-48214763 TAGCAGGAATGAAAGGAAGGAGG - Intronic
1167383562 19:49151732-49151754 AAGTAGGAATCGAAGGGGCGGGG - Intronic
1167498790 19:49834252-49834274 CATTGGGAATGCAGGGGAGGAGG + Intronic
1167535745 19:50050479-50050501 GAGTAGGCGGGGAAGGGAGGTGG - Intronic
1168018827 19:53594464-53594486 CATTGGGACTGGAATGGAGGTGG + Intergenic
1168483526 19:56741081-56741103 AAGAAGGAAGGGAAGGGAAGGGG - Intergenic
1168589089 19:57617899-57617921 CTGTAGTAATAGAAGTGAGGTGG + Intronic
1168594067 19:57660775-57660797 AACTAGGCAAGGAAGGGAGGAGG - Intergenic
925169747 2:1743652-1743674 GAGGAGGAGGGGAAGGGAGGAGG + Intronic
925242478 2:2344083-2344105 CAGTAGGAGTGGTAGAGAGGAGG - Intergenic
925729516 2:6908401-6908423 CAGTAGGAAAGGGTGGGATGTGG + Intergenic
926244510 2:11113231-11113253 AAGGAGGAAGGGAAGGAAGGAGG - Intergenic
926456091 2:13070128-13070150 CAGTAAATAAGGAAGGGAGGGGG - Intergenic
927554671 2:24023389-24023411 CAGTAGGAATGGCGGGGGGCCGG + Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927867043 2:26595821-26595843 TAGTAGTGATGGGAGGGAGGTGG + Intronic
928000665 2:27520478-27520500 AAGTAGGAAGGGGAGGGATGTGG + Intronic
929162811 2:38849895-38849917 CAATAGAAATTCAAGGGAGGAGG - Intronic
929181936 2:39050090-39050112 GAGCAGGAATGGAAGGGCTGTGG + Intronic
929538432 2:42800293-42800315 CAGTAGTAGTGGTAGGGACGGGG + Intergenic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929788898 2:45009886-45009908 CAGGAGGAAGGGGAGGGAGAGGG + Intergenic
929860710 2:45675054-45675076 GAGAAGGAAAGGAAGGGATGAGG + Intronic
930348293 2:50215174-50215196 GAGTAGGATTAGAATGGAGGTGG - Intronic
930361588 2:50387183-50387205 CAGGAGGAATGAAAAGGAGGTGG + Intronic
930774247 2:55157131-55157153 AATTAGGAAGGGAAGGAAGGAGG + Intergenic
931826248 2:66004023-66004045 GAGGAGGGAAGGAAGGGAGGAGG - Intergenic
931881500 2:66575519-66575541 CGGTAGGAAACGGAGGGAGGCGG + Intergenic
932564829 2:72899653-72899675 AAGCAGGAAAGGAAGGAAGGAGG + Intergenic
932568925 2:72926987-72927009 CAGTAGAAATGCATGGCAGGGGG - Intronic
932580590 2:72990502-72990524 CAGTAGCAATGAAGAGGAGGGGG + Intronic
932703862 2:74008751-74008773 GAGTAGGAAGGGAGGGGTGGGGG + Intronic
933234518 2:79850299-79850321 AAGGAAGAAAGGAAGGGAGGGGG - Intronic
933674326 2:85040467-85040489 CAGGAGAAATGGAAAAGAGGTGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933899298 2:86837692-86837714 GAGTAAGGATGAAAGGGAGGGGG + Intronic
935370459 2:102340922-102340944 CAGGAGGAAGTAAAGGGAGGAGG - Intronic
935781260 2:106511536-106511558 GAGTAAGGATGAAAGGGAGGGGG - Intergenic
935981363 2:108631217-108631239 AACTAGGAAGGGAAGGGCGGAGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936477004 2:112848133-112848155 CATTAGGAAGGAAAGGAAGGAGG - Intergenic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
937669909 2:124527486-124527508 CAGTAAGAATGGGAAGGGGGTGG - Intronic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
937896097 2:126977662-126977684 CAGCAGCAAAGGAAGGCAGGAGG - Intergenic
937985877 2:127637907-127637929 CAGGAAGGAAGGAAGGGAGGGGG - Intergenic
938414719 2:131094431-131094453 GATTAGTGATGGAAGGGAGGAGG + Intergenic
939532510 2:143382122-143382144 AAGAAAGAAAGGAAGGGAGGAGG - Intronic
939549037 2:143590589-143590611 CAGGAGGAATGGATGGTTGGGGG - Intronic
940280051 2:151979285-151979307 CATCAAGAATGGCAGGGAGGAGG - Intronic
941611698 2:167669028-167669050 CAGTAGAATGGGGAGGGAGGGGG - Intergenic
941660559 2:168191899-168191921 CTGTAGGAATCAAAGGGAGGAGG + Intronic
942564661 2:177254520-177254542 CATTAGGAATTGTATGGAGGTGG + Intronic
943362944 2:186943893-186943915 CAGTAAGAATTTAAGGGATGTGG + Intergenic
943595476 2:189850154-189850176 CAGTTGGAATGGCAGAGAAGGGG + Intronic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
943743617 2:191438064-191438086 CAATGGGAATGGAATGGGGGTGG - Intergenic
943896406 2:193367633-193367655 CAGGAGGAAAGGGTGGGAGGGGG - Intergenic
944527575 2:200635684-200635706 CAGCATGCATGGAAGGAAGGAGG + Intronic
944897768 2:204182790-204182812 CAGTAGAAAAGGTTGGGAGGGGG + Intergenic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
945058320 2:205887334-205887356 GGGTAGGAATGGCAGGCAGGTGG - Intergenic
945551796 2:211229499-211229521 CATTAGGAAAGGAAGGGAAGAGG + Intergenic
946449265 2:219765760-219765782 CAGAAGGAGTGGAAGGGAGGTGG - Intergenic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
947330892 2:229028063-229028085 CAGTGGGAAAGGACAGGAGGAGG + Intronic
947350618 2:229240543-229240565 CAGAAATAATGGAAAGGAGGAGG - Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947962681 2:234252832-234252854 CAGAGGGAATGGGAGGTAGGAGG - Intergenic
948151639 2:235749321-235749343 CAATAGTAATGGAATGGATGGGG + Intronic
948695156 2:239729550-239729572 AGGTAGGACTGGAAAGGAGGTGG - Intergenic
948724983 2:239929050-239929072 CAGTGGGAAGGCACGGGAGGGGG - Intronic
1168753877 20:302256-302278 AAGAATGAATGGAATGGAGGAGG - Intergenic
1169424743 20:5487069-5487091 GAGGGGGAATGGCAGGGAGGAGG - Intergenic
1169965706 20:11214918-11214940 CAGAAGGAAAAGGAGGGAGGGGG + Intergenic
1170278479 20:14619469-14619491 AAGGAGGAAAGGAAGGAAGGAGG + Intronic
1170501807 20:16982419-16982441 CAGGAGGGAAGGGAGGGAGGAGG - Intergenic
1170509025 20:17058004-17058026 AAGAAGGAAGGGAAGGGAGGAGG + Intergenic
1170679056 20:18508646-18508668 CAGTAGGAAAAGGAGGGAGCAGG + Intronic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1171178440 20:23073381-23073403 CAGTAGGAGAGGAAGGGAAGTGG - Intergenic
1171285078 20:23930289-23930311 CAGTGAGAATGGGAGGGTGGGGG + Intergenic
1172165852 20:32898652-32898674 CGGTGGGGCTGGAAGGGAGGGGG + Intronic
1172939116 20:38642633-38642655 AAGAATAAATGGAAGGGAGGTGG - Intronic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1173384269 20:42573624-42573646 AAGTTTGAATGGAAGGAAGGAGG - Intronic
1173657407 20:44709890-44709912 CAGCAGGGCTGGAAGTGAGGAGG - Intergenic
1173818950 20:46008597-46008619 CTGTATGAAAGGGAGGGAGGGGG - Intergenic
1173965258 20:47107792-47107814 AAGAAGGAAGGGAAGGGAAGGGG + Intronic
1174114462 20:48217494-48217516 CAGGAGGAAACGATGGGAGGAGG + Intergenic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174724300 20:52845291-52845313 GAGGAAGAAAGGAAGGGAGGGGG - Intergenic
1174926595 20:54766896-54766918 CAGTAGATTTGGAAGGAAGGAGG - Intergenic
1175153585 20:56954448-56954470 CAGTGAGAATGGAAGTGAAGTGG - Intergenic
1175384362 20:58584755-58584777 GAGGAGGGAAGGAAGGGAGGAGG - Intergenic
1175540940 20:59747213-59747235 CAGATGGACAGGAAGGGAGGAGG - Intronic
1175891518 20:62318033-62318055 GAGGAGGAAAGGATGGGAGGGGG + Intronic
1176451843 21:6869761-6869783 CACTAAGACTGGAAGTGAGGGGG + Intergenic
1176830015 21:13734812-13734834 CACTAAGACTGGAAGTGAGGGGG + Intergenic
1176937489 21:14883580-14883602 TGGGAGGAAGGGAAGGGAGGTGG + Intergenic
1178102384 21:29283683-29283705 CAGGAGGAAGGGAAAGAAGGGGG + Intronic
1178337879 21:31759937-31759959 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1178708932 21:34897226-34897248 CAATAGGAATTGAAAGGTGGGGG - Intronic
1179073939 21:38100231-38100253 CAGGTGGAATGGAAGGGTGATGG - Intronic
1179291219 21:40019933-40019955 CAGGAGGAAGGGAAAGAAGGAGG - Intronic
1179340151 21:40500113-40500135 CAGCAGTACTGGGAGGGAGGAGG + Intronic
1179535004 21:42045747-42045769 AAGTAGGACAGGAAGGGAAGGGG - Intergenic
1180209800 21:46288049-46288071 CATTAGGAGGGGAAGGGGGGTGG - Intronic
1180230387 21:46423751-46423773 GAGGAGGAAGAGAAGGGAGGGGG + Intronic
1180802316 22:18637654-18637676 GAGTAGCAATGAAGGGGAGGAGG + Intergenic
1180853551 22:19033206-19033228 GAGTAGCAATGAAGGGGAGGAGG + Intergenic
1180915599 22:19484311-19484333 CAGTAGAAAAGGAAGGGGTGGGG - Intronic
1181219410 22:21357607-21357629 GAGTAGCAATGAAGGGGAGGAGG - Intergenic
1181711850 22:24696152-24696174 GAGGAGGAATGGGAAGGAGGAGG - Intergenic
1181767201 22:25100388-25100410 CAAATGGAGTGGAAGGGAGGAGG + Intronic
1181902194 22:26165712-26165734 ATGGATGAATGGAAGGGAGGAGG + Intergenic
1182106123 22:27691020-27691042 AAGAAAGAATGGAAGGAAGGAGG + Intergenic
1182474522 22:30569378-30569400 CAGCAGGTATGGAGGAGAGGAGG + Intronic
1182746049 22:32606199-32606221 AAGCAGGAAGGGAAGGGAAGGGG + Intronic
1183421718 22:37715662-37715684 CAGAAGGAAGGGAAGGGAATTGG - Intronic
1183437126 22:37802717-37802739 GAGTTGGAGGGGAAGGGAGGGGG - Intergenic
1183988929 22:41585067-41585089 CAGTTGGAGTGGGTGGGAGGTGG + Intronic
1184041891 22:41949282-41949304 CAGAAGAGATGGATGGGAGGAGG + Intergenic
1184340094 22:43881253-43881275 CAGGAGGACTGGCAGGGAGCTGG + Intronic
1184672556 22:46023039-46023061 AAGGAGGAAGGGAAGGAAGGAGG + Intergenic
1184960901 22:47927739-47927761 CACAAGGAATGGGTGGGAGGTGG + Intergenic
1185139891 22:49094225-49094247 GAGGAAGGATGGAAGGGAGGGGG + Intergenic
1185197135 22:49478697-49478719 CAGGAGGAAGAGAGGGGAGGGGG + Intronic
1185285363 22:49997529-49997551 CACTGGGGAAGGAAGGGAGGCGG - Intronic
949363842 3:3259583-3259605 CAGTACTAGTGGAAGGGAGAGGG - Intergenic
950190409 3:10972570-10972592 CAGCAGGAGTCGGAGGGAGGGGG + Intergenic
950654507 3:14428196-14428218 CAGTTGGAATAGAAGGGAGGGGG + Intronic
950693769 3:14682355-14682377 CTGGAGGAATGGAAGGGCTGGGG - Intronic
950907559 3:16552972-16552994 AAGAAGGAAAGGAAGGGAAGGGG + Intergenic
951401030 3:22231641-22231663 CAGTAGGTATGGAAGACAGAAGG - Intronic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
952057377 3:29464230-29464252 CAGTAAGACTGGGAGGTAGGAGG + Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952621062 3:35343120-35343142 CAGGAGGCATGGTAAGGAGGAGG - Intergenic
953040256 3:39249985-39250007 AATTAGAAATAGAAGGGAGGGGG + Intergenic
953054507 3:39377275-39377297 GGGAAGGAATGGAAGGGAGGAGG - Intergenic
953395887 3:42569397-42569419 CAGTAGTAATGGCAGGTAGCAGG + Intronic
953582707 3:44171787-44171809 CACGAGAAATGTAAGGGAGGTGG - Intergenic
954387795 3:50253370-50253392 CAGGAGGAATGACAGGCAGGTGG + Intronic
954411770 3:50374137-50374159 AGGAAGGAATTGAAGGGAGGGGG + Intronic
955058119 3:55474096-55474118 AAGGAGGAAAGGAAGGGAAGAGG + Intronic
955921437 3:63960616-63960638 GACTGGGAAAGGAAGGGAGGAGG + Intronic
956015915 3:64882390-64882412 CAGAAGGAGTGGGAGGAAGGAGG - Intergenic
956197834 3:66670988-66671010 AAGAAAGAATGGAAGGGAGTGGG + Intergenic
956203918 3:66736660-66736682 CAGTAGGGAGGGAAGAGGGGAGG - Intergenic
956311204 3:67882584-67882606 CAGTAGCAAGGGAAGGTAGAAGG - Intergenic
957212086 3:77272399-77272421 CAGGAGGAAGAGAAGGGCGGGGG + Intronic
958020679 3:87991400-87991422 AAGTAGGATTGCAAAGGAGGAGG + Exonic
958028902 3:88083084-88083106 CAGTAGGATTGGTGGTGAGGAGG - Intronic
958106635 3:89082342-89082364 GAGCAGGAGTGGAATGGAGGAGG - Intergenic
958150249 3:89684086-89684108 AAGTAGGAAGGGAAAGGAGTTGG - Intergenic
958820385 3:98966978-98967000 CAGTAGGAATGAAAAGGGTGTGG - Intergenic
959932934 3:112002615-112002637 CAGTGTGAATGGAAGGGACCCGG + Intronic
960202875 3:114859256-114859278 AAGGAAGAATGGAAGGAAGGAGG - Intronic
960396305 3:117141792-117141814 GGGAAGGAAGGGAAGGGAGGGGG - Intergenic
960715415 3:120570017-120570039 AAGTAGGAATGGAGAAGAGGGGG + Intergenic
960806689 3:121590487-121590509 CAGAAGGAAGGGAGAGGAGGAGG - Intergenic
960946237 3:122968592-122968614 CAGTAGAAATGAAAGGGCAGTGG + Intronic
961003405 3:123389012-123389034 CAGGAGTCATGGAAGGAAGGAGG + Intronic
961340210 3:126212601-126212623 CGGGAGGAAGGGAAGGAAGGAGG + Intergenic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
961866706 3:129958694-129958716 CTGTAGGATTGGAACTGAGGTGG + Intergenic
962648286 3:137462319-137462341 GAGGGAGAATGGAAGGGAGGGGG + Intergenic
963711853 3:148755437-148755459 GAGGAGGAATAGAAAGGAGGAGG - Intergenic
964373642 3:156028322-156028344 TAGGAGGGAGGGAAGGGAGGTGG + Intergenic
964633184 3:158834586-158834608 CAGTAGGAATGGAATGGATTGGG + Intergenic
964671954 3:159236399-159236421 CAGCAGGGATAGAAGGGAAGTGG + Intronic
964791882 3:160460456-160460478 CAGCAGGAATGGAGAGGTGGGGG + Intronic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967153098 3:186667590-186667612 TAGTAAGACTGGATGGGAGGAGG + Intronic
967173515 3:186842697-186842719 CAGTCAGAATGGAAGTGAGGAGG - Exonic
967595761 3:191325447-191325469 CAGTAGGAAAAGAAGGGAAAGGG + Intronic
967814258 3:193786035-193786057 CATCAGGCTTGGAAGGGAGGCGG - Intergenic
968382897 4:110443-110465 GAGAAAGAAAGGAAGGGAGGAGG + Intergenic
969547680 4:7842506-7842528 CAGGAGGAAAAGAAGGAAGGTGG + Intronic
969944111 4:10765247-10765269 CAGAAGGAAAGGCAGGGAGATGG - Intergenic
970393637 4:15642683-15642705 AAGTAGGAATGGAAGCCATGTGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971010820 4:22432283-22432305 AACTGGGAATGGCAGGGAGGGGG + Intronic
971454774 4:26834088-26834110 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
971598324 4:28560238-28560260 CAGAAGGGAAGGAAGGGAAGAGG + Intergenic
972736423 4:41846102-41846124 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
972846551 4:42998262-42998284 AAGTAAGAATGGAAAGGAAGTGG - Intronic
973881253 4:55273580-55273602 CAGTAGGAGTGGCAGAGATGTGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974595163 4:64004632-64004654 AAGCAGGAATGAAAGTGAGGGGG - Intergenic
974709422 4:65571036-65571058 AGGTAGGAAGAGAAGGGAGGGGG - Intronic
974808036 4:66907081-66907103 GACTAGGAATGGCAGGAAGGAGG - Intergenic
975333849 4:73152479-73152501 CAGAAGGAGAGGAAGGGAAGGGG + Intronic
975788442 4:77920746-77920768 AAGGATGAATGGAAGGGAGAAGG - Intronic
975829723 4:78356643-78356665 CAGATGCAATGGAGGGGAGGAGG + Intronic
976366474 4:84238583-84238605 CAATAGGAATAGAAAGGACGGGG + Intergenic
976986871 4:91311980-91312002 TTGTAGGAATGAAAGTGAGGAGG + Intronic
978021542 4:103819543-103819565 CCTTGGGAATGGCAGGGAGGGGG + Intergenic
978343202 4:107739029-107739051 CAGAAAGAATGGAAGGAAGCTGG + Intergenic
978417173 4:108488807-108488829 AAGGAGGAATGGAAGTGAGTGGG - Intergenic
978490186 4:109303338-109303360 CAGTGGGAAGAGAAGGGAAGTGG - Intergenic
978739209 4:112118923-112118945 AAGAAGGAAGGGAAGGGATGGGG + Intergenic
979111626 4:116764303-116764325 CAAAAGGAAAGGAAGGAAGGAGG + Intergenic
979333054 4:119438578-119438600 AAGGAGGAAGGGAAGGAAGGAGG + Intergenic
979667025 4:123323399-123323421 CAGGAGGAAAGGATGGGAAGCGG + Intergenic
979675758 4:123408883-123408905 TAGTAGGAAGGGAAAGGGGGCGG + Intergenic
979678582 4:123435453-123435475 CACCAGGCAGGGAAGGGAGGGGG + Intergenic
979831579 4:125311763-125311785 GAGAAGGAAGGGAAGGGAAGAGG + Intergenic
979892298 4:126113966-126113988 TAGAGGGAGTGGAAGGGAGGTGG - Intergenic
981027182 4:140088461-140088483 CAGTGGGAATGGAAAGGAAGAGG - Intronic
981311151 4:143299246-143299268 CAGTAGGAAAGGAAGAGGAGGGG - Intergenic
981491817 4:145347792-145347814 GAGGAGGAAGGGAAGGGCGGTGG + Intergenic
981509604 4:145541296-145541318 CAGTTGCAAGGGATGGGAGGAGG + Intronic
982130585 4:152225317-152225339 CAGGTGGCATAGAAGGGAGGTGG + Intergenic
982545159 4:156724465-156724487 CAATAAGCATGGGAGGGAGGTGG + Intergenic
982722013 4:158869113-158869135 CAGGAGGAACGGGAGGGAGGAGG + Exonic
982744065 4:159087977-159087999 CAGTAGGAATGGTGGTGGGGAGG + Intergenic
983012538 4:162564875-162564897 AAGAAGGAAGGGAAGGGAGAAGG + Intergenic
984164118 4:176287258-176287280 CAGGAGGTATGACAGGGAGGGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985046570 4:185946998-185947020 GAGTAGAAATTGATGGGAGGAGG - Intronic
985393510 4:189516157-189516179 AAGAAGGAATGGAAGTGAGATGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985663624 5:1169855-1169877 CAGCAGGGAAGGAGGGGAGGAGG + Intergenic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
987074066 5:14364442-14364464 GAGTAGAAATGGATGGGATGTGG + Intronic
987305172 5:16630712-16630734 CAGTAGGCATTGCAGGGAGATGG + Intergenic
987566376 5:19593555-19593577 AAGTGGGAAAGAAAGGGAGGAGG - Intronic
987714273 5:21546536-21546558 CAGTAGGAGTTGAAGGAATGGGG + Intergenic
988006494 5:25418482-25418504 CAGGAGGAAGGGGAGGGAGGAGG + Intergenic
988683218 5:33503219-33503241 GAGGAGGAAGGGAAGGGAGGGGG - Intergenic
989125720 5:38050717-38050739 CAGAAGGGAAGGAAGAGAGGTGG + Intergenic
989130149 5:38099296-38099318 AAGAAAGAAGGGAAGGGAGGAGG - Intergenic
990156947 5:52888302-52888324 GAGGAGGAAAGGAAGGGAAGAGG + Intronic
990358648 5:54996034-54996056 CATCAGGAATTAAAGGGAGGTGG + Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990852912 5:60227520-60227542 TAGAAGGGAGGGAAGGGAGGAGG + Intronic
990852923 5:60227553-60227575 TAGAAGGGAGGGAAGGGAGGAGG + Intronic
991145123 5:63292983-63293005 CAGTTGGAATGGAAGGTTGAGGG - Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991646676 5:68807978-68808000 GAGTGGGAAGGGAAGGGAGGGGG + Intergenic
991666899 5:69008354-69008376 GGGTGGGAGTGGAAGGGAGGGGG - Intergenic
991970323 5:72134821-72134843 GAGTAGAAAAGGAAGGCAGGCGG + Intronic
992983759 5:82205437-82205459 CAGGAGGAAGGGAAGATAGGAGG + Intronic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
993904003 5:93603890-93603912 GAGGCGGAATGGAAAGGAGGAGG + Intergenic
993969369 5:94398013-94398035 CAGGAAGAACGGGAGGGAGGAGG - Intronic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994238667 5:97394278-97394300 CATTAAGTAAGGAAGGGAGGGGG - Intergenic
994419639 5:99516079-99516101 GAGTAGAAGTGGAAGGGAGTGGG - Intergenic
994487569 5:100399062-100399084 GAGTAGAAGTGGAAGGGAGTGGG + Intergenic
994684876 5:102937335-102937357 CACTAGAAATGGAAAGGAAGAGG + Intronic
995372874 5:111439376-111439398 CAGTAAGCAGGGAAAGGAGGTGG + Intronic
996405593 5:123099617-123099639 AAGGAGGAAGGGAAGGGAGCGGG - Intronic
996517396 5:124387360-124387382 CAGTAGGAAAGGGTGGGAAGGGG - Intergenic
997852666 5:137346552-137346574 CAGGAGGAATGCAAATGAGGTGG + Intronic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998880265 5:146638226-146638248 GAGTAGCAACTGAAGGGAGGTGG - Intronic
999273180 5:150310024-150310046 GAATAGGGAAGGAAGGGAGGAGG - Intronic
999297147 5:150466841-150466863 CAGGAGGAAAAGAAGGCAGGAGG - Intergenic
999329381 5:150662315-150662337 CAGGAGGAAGAGAAGGGACGAGG + Intronic
999383165 5:151136003-151136025 CAGAAGCAATGGCAGGAAGGAGG + Intronic
999933703 5:156462084-156462106 CAAAAGAAATGGATGGGAGGTGG + Intronic
1002467783 5:179416378-179416400 GAGTAGGGAAGGAAGAGAGGTGG - Intergenic
1003122371 6:3328893-3328915 GAGTAAGAAGGGGAGGGAGGGGG - Intronic
1003486910 6:6588018-6588040 AAGTAGGAAGGGTGGGGAGGTGG - Intergenic
1003801874 6:9679062-9679084 AAGGAGGAAGGGAAGGGAAGTGG - Intronic
1004110306 6:12711429-12711451 CAGTTGGAGTGGATGGGAAGGGG + Intergenic
1005500072 6:26421791-26421813 GAGGAGGAAGTGAAGGGAGGAGG + Intergenic
1005504548 6:26458309-26458331 GAGGAGGAAGTGAAGGGAGGAGG + Intronic
1005589511 6:27310085-27310107 CAGTAGGAATTGTAGGATGGTGG + Exonic
1005802928 6:29445378-29445400 CAGATGGAAGGGAAGGGAGAAGG + Intronic
1006187894 6:32190940-32190962 CAGTAAGAAGGGAAGGTGGGTGG - Exonic
1006237061 6:32642816-32642838 CAGTATGAAAGGAAGGAAAGTGG + Intronic
1006424929 6:33957978-33958000 CAGCAGGGGAGGAAGGGAGGAGG + Intergenic
1007180152 6:39923731-39923753 CAGTAGGAGCTGAAGGGAGCTGG + Intronic
1007286123 6:40748697-40748719 CAGTAGGAAGCCAAGGGAGCAGG - Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007463511 6:42035322-42035344 CAGTAGAAATGGAAACAAGGGGG - Intronic
1007514156 6:42398081-42398103 CAGTAGGATGGGAAGGGCAGGGG + Intronic
1007701310 6:43768103-43768125 GAGAAGGGATGCAAGGGAGGGGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008024928 6:46624592-46624614 CAGTAATCATGGAAGGGAGAGGG + Intronic
1009002453 6:57735543-57735565 CAGTAGGAGTTGAAGGAATGGGG - Intergenic
1009194691 6:60669604-60669626 CAATGTGAATGGAAGTGAGGAGG + Intergenic
1010230921 6:73534428-73534450 AAGGAAGAAAGGAAGGGAGGAGG + Intergenic
1010704378 6:79090052-79090074 AGGAAAGAATGGAAGGGAGGAGG - Intergenic
1010806775 6:80246490-80246512 TAGTAGCAATGGCAGGAAGGGGG - Intronic
1011027448 6:82884774-82884796 AAATACGAATGGAAGGGAGGAGG + Intergenic
1012734180 6:102918007-102918029 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1012734207 6:102918105-102918127 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1012824396 6:104128426-104128448 CAGAAGGAAAGGAAGGGAAGGGG + Intergenic
1012975796 6:105779782-105779804 GAGCAGGACTGGCAGGGAGGTGG + Intergenic
1013032738 6:106351082-106351104 CACTAGCAAAGGAAGGGAAGTGG - Intergenic
1013417567 6:109938602-109938624 AATTAGGGGTGGAAGGGAGGTGG - Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1014431687 6:121378422-121378444 CAGTAGGAAAGGAAGGAATAGGG - Intergenic
1015384731 6:132608897-132608919 CAATAGCAATGGAACAGAGGTGG + Intergenic
1015751687 6:136566334-136566356 CAGAAGGCATGGGTGGGAGGAGG + Intronic
1015932601 6:138376315-138376337 CAGTAAGCATAGAAGGGAGGAGG - Intergenic
1016324552 6:142885308-142885330 GAGAAGGAGGGGAAGGGAGGGGG - Intronic
1016984804 6:149887176-149887198 CAGTAGGGATTTAAAGGAGGTGG - Intronic
1017727799 6:157287674-157287696 CAGAAGGGAGGGAAGGGAGGAGG - Intergenic
1018017402 6:159724880-159724902 GAGAAGGGAAGGAAGGGAGGGGG + Intronic
1018101879 6:160447321-160447343 CAGGAGGAATCGGAGGGAGAGGG + Intronic
1018855379 6:167670650-167670672 CAGGAGGAAGAGAAGGGATGAGG - Intergenic
1018866021 6:167747702-167747724 AAGGAGGGAAGGAAGGGAGGAGG + Intergenic
1019369686 7:655114-655136 CACTAAGAATAGAAGGTAGGGGG - Intronic
1019720374 7:2566918-2566940 CAGAAGGAATGGGTGGGTGGGGG - Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020503685 7:8956351-8956373 CAGGAAGAATGGATGGGAGTAGG - Intergenic
1022278736 7:28883318-28883340 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1022312567 7:29210922-29210944 AAATAGGACTGGCAGGGAGGAGG + Intronic
1022332283 7:29391318-29391340 AGGTAGGAAGGGAAGGGAAGAGG + Intronic
1022972792 7:35532566-35532588 AAGGAGGAATGGAAAGGAGGTGG + Intergenic
1023074474 7:36469414-36469436 CAGGAGGCATGGGAAGGAGGAGG - Intergenic
1023156462 7:37256769-37256791 GAGGAGGAAGGGAAGGGAGAAGG + Intronic
1023352592 7:39335170-39335192 AGGTATGAATGGAAGGGAGGTGG - Intronic
1023755192 7:43409631-43409653 CACGTGGGATGGAAGGGAGGTGG - Intronic
1024016909 7:45325520-45325542 CAGCAGGACTGGAAGGGGGAGGG + Intergenic
1024604390 7:51012402-51012424 AAGGAGGGAAGGAAGGGAGGAGG + Intergenic
1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG + Intergenic
1026296750 7:69059561-69059583 CAATATGAAGGGAAGGCAGGCGG - Intergenic
1026398601 7:69985580-69985602 CAGTGGGAATGGAAGTGGGCAGG - Intronic
1026608677 7:71837914-71837936 CAGGAGGGATGAAAAGGAGGGGG + Intronic
1027111489 7:75443120-75443142 AAGTAGAAATGGAAGTGGGGGGG - Intronic
1027283720 7:76627653-76627675 AAGTAGAAATGGAAGTGGGGGGG - Intergenic
1028518944 7:91707721-91707743 CAGTAGGAATGGGTGTGTGGAGG - Intronic
1029108353 7:98196361-98196383 TAGTAAGAGTGGAAGGGAGAAGG + Intronic
1029257105 7:99277150-99277172 CAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029831678 7:103267035-103267057 CAGTGGGAGAGGAAGGGATGAGG - Intergenic
1029978029 7:104852374-104852396 CACTAGGCAGGAAAGGGAGGTGG + Intronic
1030079036 7:105761693-105761715 CAGGGGGAATGGAATGGCGGTGG + Intronic
1030516749 7:110548576-110548598 CAGTAAGAATGGAGAGCAGGAGG - Intergenic
1030921537 7:115395593-115395615 CAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1031008958 7:116503832-116503854 AAGAAGGAAGGGAAGGGAAGAGG + Intronic
1031805656 7:126303608-126303630 CAATAGGAACGGGATGGAGGAGG + Intergenic
1031837876 7:126700989-126701011 AAGAAGGAATGGAAGAGAAGGGG - Intronic
1032409912 7:131687332-131687354 CAGAGGCAATGGAAGGGAAGGGG - Intergenic
1032494495 7:132350685-132350707 TGGTGGGAATGGAAGTGAGGTGG + Intronic
1032529575 7:132609098-132609120 CACTGGGAATGGGACGGAGGGGG - Intronic
1032552039 7:132793101-132793123 CAGGAGAAATGGAAAGGAGCGGG - Intronic
1033143991 7:138855257-138855279 CAGGAGGACTGGAAAAGAGGAGG - Intronic
1034445575 7:151112464-151112486 CAGTAGGATGGGAAAGAAGGGGG - Intronic
1034552810 7:151832237-151832259 GAGGAGGGAAGGAAGGGAGGAGG + Intronic
1034552816 7:151832253-151832275 GAGGAGGGAAGGAAGGGAGGAGG + Intronic
1034552822 7:151832269-151832291 GAGGAGGGAAGGAAGGGAGGAGG + Intronic
1034860071 7:154587339-154587361 CAGTGGGAATGGTTGGGGGGAGG - Intronic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035889583 8:3329049-3329071 CTGTTGGCATGGAATGGAGGTGG + Intronic
1036079465 8:5539018-5539040 AAGTAGAAATGGAATGCAGGAGG - Intergenic
1036457376 8:8921884-8921906 CAGTAGGAAAGGAAGAGATGAGG - Intergenic
1036688171 8:10925245-10925267 GAGGAGGAAAGGAAGGGAAGCGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037691443 8:21184587-21184609 CTGGAGGAAGGGAAGGGACGCGG - Intergenic
1037883743 8:22585649-22585671 CAGCAGGATGGGAGGGGAGGGGG - Intronic
1037928602 8:22864591-22864613 CAGTAGGAATCGAAGTGACTCGG + Intronic
1038200880 8:25411486-25411508 CATGTGGACTGGAAGGGAGGTGG - Exonic
1038332076 8:26616868-26616890 CACGTGGAATAGAAGGGAGGAGG - Intronic
1038464752 8:27751209-27751231 CAGCAGCAATGGAAGGGATAAGG + Intronic
1038806345 8:30795958-30795980 CAGAAAGAAAGGAAGGAAGGAGG + Intronic
1039458931 8:37727317-37727339 CAGGAGGAGGGGAAGGGTGGAGG + Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039903878 8:41772430-41772452 GAGAAGAAATGGAGGGGAGGAGG - Intronic
1040011723 8:42666683-42666705 GAGTAAGAAAGGAAGGGAGGAGG + Intergenic
1040062408 8:43115222-43115244 TAGAAGGGATGGAAGGGATGAGG - Intronic
1040515564 8:48131192-48131214 CCTTGGGAATGGCAGGGAGGTGG + Intergenic
1040620058 8:49082000-49082022 AAGAAGGAAGGGAAGGGAAGGGG + Intergenic
1040639703 8:49319190-49319212 CAGCAGAAATGCATGGGAGGTGG - Intergenic
1041485189 8:58368860-58368882 AAGGAGGAATGGTAGGGAGAAGG + Intergenic
1041527262 8:58821296-58821318 TAGTAGGTATAGAAAGGAGGGGG - Intronic
1042230052 8:66545799-66545821 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043045062 8:75312781-75312803 GAGAAGGAATGGAAGGAAGGAGG + Intergenic
1043074324 8:75676991-75677013 AAGTATGAAGGGAAGGAAGGAGG + Intergenic
1044335635 8:90981563-90981585 AAGGAGGAATGTAAGGAAGGAGG - Intronic
1044544634 8:93445940-93445962 CAGCTGCAAAGGAAGGGAGGAGG - Intergenic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044878140 8:96693239-96693261 AAGGAGGAAGGGTAGGGAGGGGG + Intronic
1044906920 8:97014195-97014217 CAGTAGGAATGTAAAGGAGGGGG + Intronic
1045251345 8:100485612-100485634 TGGTAGGAATGGAGGTGAGGAGG + Intergenic
1045412011 8:101929352-101929374 GAAAGGGAATGGAAGGGAGGAGG + Intronic
1045772853 8:105764910-105764932 CTGAAGGAAAGGAAGAGAGGTGG - Intronic
1046395041 8:113631083-113631105 CAGGAGGAAAGGGTGGGAGGGGG + Intergenic
1046732998 8:117745919-117745941 TAGTAGGACTGGGAGGGAGTGGG - Intergenic
1047406091 8:124586852-124586874 CAGTGGGAATGGGAAGGAGGGGG + Intronic
1047696201 8:127406203-127406225 AAGAAGGAAGGGAAGGGAAGGGG + Intergenic
1047893009 8:129333801-129333823 CAGTAAGAATGGAAGAAGGGAGG + Intergenic
1048163310 8:132040141-132040163 AAGGAGGAATTGAGGGGAGGAGG - Intronic
1048214604 8:132482436-132482458 AAGAAGGAAGGGAAGGGAGTAGG + Intergenic
1048280941 8:133105335-133105357 CAGTAGGGGTGGACCGGAGGTGG + Intronic
1048340328 8:133533709-133533731 AATTAGGAGTGGAAGGGAGATGG - Intronic
1048398269 8:134036110-134036132 CAGTCGGAATAGAAGAGAAGAGG + Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049102319 8:140588625-140588647 AAGGAGGAAGGGAAGGAAGGAGG + Intronic
1049315555 8:141965151-141965173 CTGGAGGATTGGAAGGGAGCAGG - Intergenic
1049522551 8:143101517-143101539 GGGTAGGGAGGGAAGGGAGGAGG + Intergenic
1049672579 8:143876529-143876551 CCTCAGGAAGGGAAGGGAGGAGG - Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1049943243 9:569146-569168 CAGGAAGAAAGGAAGGCAGGTGG - Intronic
1050594915 9:7195518-7195540 CAGAAGGAAAGGAAAGGAGCAGG + Intergenic
1051396337 9:16625820-16625842 CAGTAGGAATGCATGTGTGGCGG + Intronic
1052174468 9:25441663-25441685 CATTAAGAATGGAATGAAGGGGG + Intergenic
1052493859 9:29201094-29201116 CAGTATGCATAGAAAGGAGGAGG - Intergenic
1053286956 9:36855838-36855860 CATGAGGAAGGGAAGGAAGGTGG - Intronic
1053443602 9:38135423-38135445 CAGGAGGAAGGGGAGGCAGGAGG - Intergenic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1054947837 9:70814899-70814921 GAAAAGGAAAGGAAGGGAGGGGG - Intronic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1055776571 9:79772469-79772491 CAGAAGAAATGGCAGGAAGGAGG + Intergenic
1055824533 9:80307235-80307257 AAGAAGGAAGGGAAGGGAAGGGG - Intergenic
1056069724 9:82973713-82973735 GAGGAAGAAGGGAAGGGAGGAGG - Intergenic
1056450592 9:86712861-86712883 GAGAAGGAATGCAAGGGAGTGGG + Intergenic
1056713365 9:89009397-89009419 CAGTAGGATTGGGAGTGAGTGGG - Intergenic
1056827028 9:89883605-89883627 CAGGAGGCAGGGCAGGGAGGTGG - Intergenic
1057075439 9:92135931-92135953 CTGAAGGAGTGGGAGGGAGGTGG + Intergenic
1058170960 9:101680729-101680751 CAGAAGGAATAGAAGGTAAGAGG - Intronic
1058751026 9:108038372-108038394 CAGGAGGCATGGAAGGGAAGGGG - Intergenic
1059329996 9:113528880-113528902 CAGAAATCATGGAAGGGAGGAGG + Intronic
1060068551 9:120526511-120526533 AAGTAGGAATGGAGGGGGAGGGG - Intronic
1060427920 9:123521962-123521984 TAGAAGAAATGGAAGGGAGCCGG - Intronic
1061001642 9:127906021-127906043 CTGCAGGAATGGGAGGGGGGAGG - Intergenic
1061181884 9:129029326-129029348 AAATGGGAATGGGAGGGAGGGGG - Intergenic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061803164 9:133123191-133123213 CAGAAGAAAGGGATGGGAGGAGG - Intronic
1062184364 9:135209642-135209664 GAGTGGGAATGGCAGCGAGGAGG - Intergenic
1062384913 9:136305397-136305419 CTGTAGGAATGGAAGGGGGCTGG - Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1203517338 Un_GL000213v1:14754-14776 CACTAAGACTGGAAGTGAGGGGG - Intergenic
1185756944 X:2659788-2659810 GAGGAGGAATGGGAGGGAAGGGG - Intergenic
1186188621 X:7046140-7046162 GTGTAGGAATTGGAGGGAGGTGG - Intergenic
1187146689 X:16643894-16643916 CATGAGGAATGGGAGGGAGAAGG - Intronic
1187704301 X:21993994-21994016 GAGAAGGAAAGGAAGGAAGGGGG - Intronic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188114557 X:26227035-26227057 GAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1189424022 X:40882107-40882129 AAGGAGGAAAGGAAGGAAGGAGG + Intergenic
1190066098 X:47242723-47242745 GAGTGGGGATGGCAGGGAGGTGG + Intronic
1190690322 X:52908185-52908207 CAGCAGGAAGGGAAGAGAGATGG - Exonic
1190695661 X:52947607-52947629 CAGCAGGAAGGGAAGAGAGATGG + Exonic
1192034488 X:67547096-67547118 CAGGAGGAAAGGAAGAGTGGAGG - Intronic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192206364 X:69099360-69099382 CTCTATGGATGGAAGGGAGGTGG + Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192536629 X:71934025-71934047 AGGAAGGAAAGGAAGGGAGGAGG - Intergenic
1193317137 X:80077266-80077288 CAGCTGCAATGGCAGGGAGGTGG + Intergenic
1194000068 X:88417262-88417284 CAGAAGGAAAGAAAGGAAGGAGG + Intergenic
1194073005 X:89350772-89350794 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1194240025 X:91434651-91434673 CAGTAGCAGTGATAGGGAGGGGG - Intronic
1194277447 X:91902837-91902859 CAATTGGAATGAAGGGGAGGGGG - Intronic
1194388851 X:93291393-93291415 GAGAAGGAATGGAAGAGAAGTGG - Intergenic
1195118442 X:101723799-101723821 CAGAAGGAATGGAAGGTGAGAGG - Intergenic
1195538667 X:106037595-106037617 TAGTTGGAATGGATGGGTGGTGG + Intronic
1195539632 X:106047924-106047946 CTGTGGGAATGGAAGTTAGGAGG - Intergenic
1195637365 X:107133250-107133272 CAGTAGGAATGGAAGACAGCAGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196203986 X:112918337-112918359 CTGTAGGAAAGAGAGGGAGGGGG - Intergenic
1196305302 X:114095539-114095561 CATGGGGAATGGGAGGGAGGAGG - Intergenic
1196872498 X:120126005-120126027 GAGTAAGAATGTAAGGGAGTAGG - Intergenic
1198024002 X:132687248-132687270 CAGCAGAAGGGGAAGGGAGGAGG + Intronic
1198074233 X:133179511-133179533 CGGTAGGAGTGGAAGGGGGACGG - Intergenic
1198077104 X:133204379-133204401 CAGAAGGGATGGAAGGAACGTGG + Intergenic
1198475159 X:136989211-136989233 CGGTAGGTAGGGAAGGGAAGAGG + Intergenic
1199474348 X:148229296-148229318 CAGGATGAATGGAAGGGGGAGGG - Intergenic
1199537439 X:148918669-148918691 CAGGAGGAAGGAAAGGGAGGAGG + Intronic
1199974103 X:152882282-152882304 TAATGGGAATGGAATGGAGGAGG + Intergenic
1200250112 X:154548246-154548268 CAGTTGGAGAGGAAGGGATGGGG + Intronic
1200594791 Y:5124934-5124956 CAATTGGAATGAAGGGGAGGGGG - Intronic
1200727245 Y:6686512-6686534 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1200728397 Y:6702287-6702309 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1200738876 Y:6831571-6831593 CAGGAAGAAAGGAAGGAAGGAGG - Intergenic
1201558696 Y:15292080-15292102 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic