ID: 1118343284

View in Genome Browser
Species Human (GRCh38)
Location 14:64914481-64914503
Sequence GTTGACTGCGTCGCGATGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118343280_1118343284 3 Left 1118343280 14:64914455-64914477 CCCGGAAGCGTTGGAGGACATTC 0: 1
1: 0
2: 0
3: 10
4: 75
Right 1118343284 14:64914481-64914503 GTTGACTGCGTCGCGATGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 15
1118343281_1118343284 2 Left 1118343281 14:64914456-64914478 CCGGAAGCGTTGGAGGACATTCC 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1118343284 14:64914481-64914503 GTTGACTGCGTCGCGATGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118343284 Original CRISPR GTTGACTGCGTCGCGATGTG TGG Exonic