ID: 1118344809

View in Genome Browser
Species Human (GRCh38)
Location 14:64930217-64930239
Sequence TGAGAGTCCCTGTGAATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 165}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118344803_1118344809 3 Left 1118344803 14:64930191-64930213 CCTAGGCCCTGCCCAGTTGGAGC 0: 1
1: 0
2: 0
3: 30
4: 325
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344799_1118344809 16 Left 1118344799 14:64930178-64930200 CCAAATATTTTCCCCTAGGCCCT 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344802_1118344809 4 Left 1118344802 14:64930190-64930212 CCCTAGGCCCTGCCCAGTTGGAG 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344807_1118344809 -9 Left 1118344807 14:64930203-64930225 CCAGTTGGAGCCTTTGAGAGTCC 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344805_1118344809 -4 Left 1118344805 14:64930198-64930220 CCTGCCCAGTTGGAGCCTTTGAG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344804_1118344809 -3 Left 1118344804 14:64930197-64930219 CCCTGCCCAGTTGGAGCCTTTGA 0: 1
1: 0
2: 0
3: 9
4: 188
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344801_1118344809 5 Left 1118344801 14:64930189-64930211 CCCCTAGGCCCTGCCCAGTTGGA 0: 1
1: 0
2: 0
3: 24
4: 311
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344806_1118344809 -8 Left 1118344806 14:64930202-64930224 CCCAGTTGGAGCCTTTGAGAGTC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344796_1118344809 20 Left 1118344796 14:64930174-64930196 CCCTCCAAATATTTTCCCCTAGG 0: 1
1: 0
2: 3
3: 17
4: 167
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165
1118344798_1118344809 19 Left 1118344798 14:64930175-64930197 CCTCCAAATATTTTCCCCTAGGC 0: 1
1: 1
2: 0
3: 11
4: 154
Right 1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG 0: 1
1: 0
2: 2
3: 19
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118344809 Original CRISPR TGAGAGTCCCTGTGAATGAC TGG Intronic
900553787 1:3269799-3269821 GGACAGTCCCAGAGAATGACAGG + Intronic
902114789 1:14112516-14112538 TGAGGGTCCCTGGGAGTGAGAGG - Intergenic
903268010 1:22170042-22170064 TGAGAAGCCATGGGAATGACTGG + Intergenic
903447236 1:23430510-23430532 TGAAAGTCCCTGTGGATTCCAGG + Intronic
905317178 1:37090220-37090242 TGAGAGTCCATTTGAATCAGTGG - Intergenic
910929076 1:92424506-92424528 TGGGAGTAGCTGAGAATGACTGG + Intergenic
913294751 1:117308458-117308480 TGAGAGGCCCAGGGAATGCCAGG + Intergenic
915007730 1:152655646-152655668 TAAGAGTCCCTGGGAATTAGAGG + Intergenic
919376784 1:196805059-196805081 AGAGAGGCCCTGAGAGTGACAGG + Intergenic
919386488 1:196929939-196929961 AGAGAGGCCCTGAGAGTGACAGG + Intronic
919389259 1:196961858-196961880 AGAGAGGCCCTGAGAGTGACAGG + Intergenic
923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG + Intronic
924187777 1:241514207-241514229 TGAGACTACCAGTGACTGACTGG + Intronic
924672586 1:246144612-246144634 TCAGAGTCCTTGTTAATGACAGG + Intronic
1063629522 10:7720986-7721008 CCAGAGGCCCTGTGAATGCCTGG - Intronic
1066203366 10:33163010-33163032 TGTGAGCCACTGTGCATGACTGG + Intergenic
1066676770 10:37896230-37896252 TGAGAAGCCCTGTGAATGTAAGG + Intergenic
1067282512 10:44883143-44883165 TGAGCTGCCCTTTGAATGACAGG - Intergenic
1068861012 10:61848054-61848076 TGAGAGTCCCATTGAATAAAAGG + Intergenic
1069569561 10:69486120-69486142 AGAGAATGCCTGTGAAGGACTGG + Intronic
1070106587 10:73438218-73438240 TGAGAGTCCCTGGGAAGTAGTGG + Exonic
1073947477 10:108767664-108767686 TCAGACACCCTGTGACTGACAGG + Intergenic
1075066193 10:119290607-119290629 TGTGAGTCCTTGGGAATGGCTGG - Intronic
1075791217 10:125085689-125085711 CGAGAGTCCCTGTTAATGCAAGG - Intronic
1080667197 11:34346102-34346124 TGAGAGTAACTGAGGATGACAGG - Intronic
1084901488 11:72313185-72313207 TGAGAGTCCCTCTGAAGGACTGG - Intronic
1086534925 11:87832990-87833012 TAACAGTCCGTGTGAAAGACTGG - Intergenic
1091352109 11:134906060-134906082 TGGGGGTCCCTGCGAAGGACAGG + Intergenic
1091910030 12:4222719-4222741 TGAGATTCCATGTGAATGTTAGG + Intergenic
1092409814 12:8243946-8243968 TGAGGGTCCCTGGGATCGACGGG + Intergenic
1092630301 12:10369622-10369644 TGAGGGTCCTTGTGACTTACCGG - Intergenic
1094052227 12:26233207-26233229 TGAAATACCCTGTGAATTACTGG - Intronic
1094691439 12:32773296-32773318 TGAGAGTCCCTCTGAATCGGGGG + Intergenic
1101541261 12:105667572-105667594 TGAGAGGCTCTGTGGGTGACTGG - Intergenic
1101851955 12:108410360-108410382 TGACAGTCCCTAGGAATGAAAGG - Intergenic
1103518545 12:121522954-121522976 TGTGTGTCCCAGTGAATGAGGGG - Intronic
1105254571 13:18734413-18734435 TGAGAAGCCCTGTGAGTGAAAGG + Intergenic
1105359069 13:19690022-19690044 TAAGAGTCCCTGTTTATGAGTGG - Intronic
1105494028 13:20914641-20914663 TGAGATTCCATATGAATGACAGG - Intergenic
1106224690 13:27775984-27776006 TGAAAGTCCCTCTGACTGCCTGG + Intergenic
1107239351 13:38213278-38213300 TGAGAGCCCCTGCAAATCACTGG - Intergenic
1109428513 13:62199982-62200004 TGATAGTCTATGTGAATGAATGG + Intergenic
1110540919 13:76706079-76706101 TGAGTGTCCCTTTCAATAACTGG - Intergenic
1110762523 13:79246006-79246028 TGAGAATACCTGTGAATATCTGG - Intergenic
1112164540 13:96904161-96904183 TGAGAGTTCCTGTGATGGAAAGG + Intergenic
1113177844 13:107586409-107586431 TTGGAGTCCCAGTGAATCACAGG - Intronic
1114223024 14:20713983-20714005 TGAGAACCCCTGTGAATTTCTGG - Intergenic
1114950738 14:27749639-27749661 TGAGTATCCCTGTGATTGACAGG + Intergenic
1117282275 14:54252878-54252900 TGAGACTCCCAGGGCATGACTGG - Intergenic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1118575201 14:67235193-67235215 TGTGAATACCTGTGACTGACTGG - Intergenic
1119665378 14:76481607-76481629 TTGAAGTGCCTGTGAATGACCGG + Intronic
1121259140 14:92553568-92553590 TGAGTGTCCCGGGGAATGGCAGG - Intronic
1121602443 14:95215888-95215910 TGAGTGTCCCTGAGAATGGCAGG - Intronic
1122905100 14:104797975-104797997 TCAGAGCCCCTGTGACTGGCTGG - Intergenic
1123149937 14:106170978-106171000 TGAGAGTCTCAGTGAACCACTGG + Intergenic
1123209151 14:106741791-106741813 TGAAAGTCTCAGTGAATCACTGG + Intergenic
1125385274 15:39130400-39130422 AGAGATTCCCTGTGGATCACTGG - Intergenic
1127929720 15:63585217-63585239 TGAGAGTCCATGTGAGTTTCAGG + Intronic
1128704543 15:69829034-69829056 TCAGAGTGCCTGACAATGACGGG + Intergenic
1128825046 15:70706942-70706964 TGAGATTCCATGTGAATGTTAGG - Intronic
1132692320 16:1187176-1187198 TGAGCGTTCCTGAGAATGAGGGG + Intronic
1134264695 16:12683178-12683200 TGAGATTCCGTTTGAATAACTGG + Intronic
1135794881 16:25432238-25432260 TGACAGTCCCGGTAAATGTCAGG + Intergenic
1136780459 16:32897357-32897379 TGAGAGTCTCAGTGAACCACTGG - Intergenic
1139592764 16:67942647-67942669 TGAGTGTCTCTGCGGATGACCGG - Intronic
1141394621 16:83693632-83693654 TGACAGTGCCAGTGAATGAATGG + Intronic
1142868845 17:2807845-2807867 TGAGAGCCCCTCTGGCTGACTGG + Intronic
1143621096 17:8080636-8080658 TGTGAGTCCGTGTGAGTGACGGG - Exonic
1144797728 17:17903836-17903858 TGAGAGATCCAGTGAATGACGGG + Intronic
1152800304 17:82327835-82327857 TGAGGGTCTCTGTGAGTGACTGG - Intronic
1152982126 18:288639-288661 TGAGAGTAGCTGAGACTGACTGG - Intergenic
1154436457 18:14346207-14346229 TGAGAAGCCCTGTGAGTGAAAGG - Intergenic
1157573219 18:48726860-48726882 TGTGAGTCACTGGGAATGAGAGG - Intronic
1158280974 18:55825929-55825951 TGAGAATCCTTGTGCATGGCAGG - Intergenic
1159606569 18:70480334-70480356 TGTGAGTCCATGTGAGTTACAGG + Intergenic
1160997061 19:1887506-1887528 TGAGAGTCCCTGGGACGGAGCGG - Intergenic
1161160715 19:2760635-2760657 TGAGAGGCCCCTTGAAAGACTGG + Intronic
1162665893 19:12211381-12211403 TGAGATTCCCTGTGAATTTTAGG + Intergenic
1162771085 19:12949657-12949679 TGCGTGACCCTGGGAATGACAGG - Intronic
1165556687 19:36639180-36639202 TGAGAAACCCTATGAATGTCGGG - Exonic
1165568018 19:36749011-36749033 TGAGAAACCCTATGAATGTCCGG - Exonic
1165669976 19:37668536-37668558 TGAGAAACCCTTTGAATGTCAGG - Exonic
1165670062 19:37669872-37669894 TGAGAAACCCTATGAATGTCTGG - Exonic
1165684094 19:37803166-37803188 TGAGAAACCCTGTGATTGCCAGG + Intronic
1166019647 19:40014749-40014771 TGAGATTCCCTATGAATGTAAGG + Exonic
1167231439 19:48286860-48286882 TGAGAAGCCCTGTGAATGAAAGG + Exonic
1167368315 19:49065954-49065976 TGAGAGACCCTGAGAAAGACAGG + Intergenic
925615616 2:5742072-5742094 TGAGAGTCTCTCTGAGTGAAAGG - Intergenic
933305648 2:80594993-80595015 TGAGAGTCCATGTGAATTTTAGG + Intronic
934486602 2:94719855-94719877 TGAGTATCCCTGTGATTGACAGG - Intergenic
934489536 2:94751280-94751302 TGAGAAGCCCTGTGAGTGAAAGG + Intergenic
934639820 2:96021223-96021245 TGGGTGTCCCAGTGAGTGACAGG + Intergenic
941413011 2:165183915-165183937 TGTGAGTTGCTGTGAAGGACTGG + Intronic
941754938 2:169174861-169174883 TGAGAGTCCCTGTTAAAAATGGG + Intronic
942327188 2:174785920-174785942 TGAAGGTCCCTGTGAATGACCGG + Intergenic
948105948 2:235413714-235413736 TGAGAGTCCCAATGAATTCCAGG + Intergenic
948392362 2:237621628-237621650 TGGGAGGCCTTGAGAATGACTGG - Intergenic
948470896 2:238177933-238177955 TGAGAACCCCTGTGCATGGCTGG - Intronic
1169043471 20:2516384-2516406 TCAGAGTCACTGTTAATGTCAGG + Intronic
1171879477 20:30607241-30607263 TGAGAAGCCCTGTGAATGAAAGG + Intergenic
1173364589 20:42373438-42373460 TGAGAGTTCTTGTCAATGATAGG - Intronic
1173966319 20:47115424-47115446 TGAGCCTCCCAGTGAATAACAGG - Intronic
1174634865 20:51990263-51990285 TGAGAGTCTGTGTGTAGGACTGG + Intergenic
1176840586 21:13839445-13839467 TGAGAAGCCCTGTGAGTGAAAGG + Intergenic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1182280105 22:29213605-29213627 TGGGAGTCTCTGTGAAGGCCGGG + Intronic
1183669788 22:39265737-39265759 AGAGAGTGCCTGTGATGGACCGG - Intergenic
1184130179 22:42512883-42512905 TGAGAGCCGCAGTGAATGGCTGG - Exonic
1184450208 22:44578133-44578155 TCAGAGTCCCTGTGTATGGTGGG + Intergenic
953574032 3:44098437-44098459 TGAGGGTCCCTGTGATTCCCTGG + Intergenic
953638500 3:44684134-44684156 TGAGAAACCCTATGAATGCCAGG - Intergenic
953873406 3:46647156-46647178 TGACAGGCTCTGTGAGTGACGGG + Intergenic
954360640 3:50121003-50121025 TGAGGGTTCCTGTGAATGTGAGG + Intergenic
957246127 3:77719189-77719211 TGAAAGTCTCTGTGAATGGAGGG - Intergenic
961000272 3:123369510-123369532 TGTGTGTCCCTGTGAGTGTCTGG + Intronic
962072120 3:132044492-132044514 AGAGAGACCCTGTGAAAGAAGGG + Intronic
965167739 3:165218029-165218051 TGAGTGTCTGTGTGTATGACTGG + Intergenic
966975859 3:185082621-185082643 CAAGAGTCTCTGTGAAGGACTGG + Exonic
967487255 3:190047524-190047546 TAAGAGTTCCTGCAAATGACAGG + Intronic
970058529 4:12002823-12002845 TGAGAGTCCCTATAAATGTTAGG - Intergenic
970364632 4:15345973-15345995 TGAGAGTCCCTGTGACAGTGTGG - Intronic
973331415 4:48913471-48913493 TGAGAGGCTCTGTGAATCACAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974481368 4:62448047-62448069 TGAGTGTCCATATGAATGAATGG + Intergenic
975362500 4:73487293-73487315 AGAGAGACCCTGAAAATGACTGG - Intronic
984693603 4:182756374-182756396 TGGGAGTCACTGAGAATGAAAGG + Intronic
985485873 5:148725-148747 TGAGATTCCCTATGAATTTCAGG - Intronic
985964576 5:3330206-3330228 TGAGAACCCCTGTGATTAACTGG + Intergenic
989245089 5:39245490-39245512 TGACAGTCCCTGAGATTGAGAGG + Intronic
989316910 5:40091851-40091873 TCAGAGACCCTGTGCAGGACTGG - Intergenic
992435399 5:76751118-76751140 TGAGAGGACCTGTGGTTGACTGG - Intergenic
998593322 5:143501056-143501078 ATAAAGTCCCTGTGAATAACTGG + Intergenic
998614144 5:143720859-143720881 TGGAAGTCACTGTGAGTGACAGG + Intergenic
1001550922 5:172601900-172601922 TGAGATTCACTGTGATTGAATGG + Intergenic
1002710649 5:181192628-181192650 TGAGGGTCCCTGTGAGGGTCTGG + Intergenic
1003534172 6:6961739-6961761 TAAGACTCCCTTAGAATGACAGG - Intergenic
1007111498 6:39315659-39315681 TGAGAGCCCATGGGAATGGCTGG - Intronic
1007261488 6:40567117-40567139 TGCAAGTCCCTGGGATTGACAGG + Intronic
1008059035 6:46977436-46977458 TGAGAGCCTCTGTGACTCACAGG + Intergenic
1010088641 6:71952422-71952444 TTAGAGTCTCTGTGATAGACAGG - Intronic
1016665429 6:146633953-146633975 TGAGAGTGACTGTGAAGGCCTGG - Intronic
1017956911 6:159186395-159186417 TGAGAGTGCTTCTGAATGAAAGG + Intronic
1017959398 6:159208697-159208719 TGAGAAGCCCTGAGAATCACAGG - Intronic
1018038844 6:159904218-159904240 TGAGAGTATCTGTGAAATACGGG - Intergenic
1018147418 6:160905507-160905529 TGAGAGCCACTGTGACTGATAGG + Intergenic
1018550782 6:164996509-164996531 TCAGAGTCCCTGGGAGTGTCAGG + Intergenic
1019895740 7:3981413-3981435 TGAGTGTCCATGTGAAAGAGAGG + Intronic
1021275292 7:18642544-18642566 TGAGAGTGCCTGTGAAGAATAGG + Intronic
1023894456 7:44420375-44420397 TGAGTGTCCCTGAAAGTGACAGG + Intronic
1024216389 7:47252750-47252772 AGTGGGTCCCTGTGAATCACAGG + Intergenic
1024483783 7:49893340-49893362 TGGGAGTCACTGAGAAAGACAGG + Intronic
1027829324 7:83157117-83157139 TGACAGTCCCAGAGAGTGACTGG + Intronic
1029152796 7:98492758-98492780 TGTGAGTCCCTGTGGATTAGAGG + Intergenic
1029215622 7:98947161-98947183 GGAGAATTCCTTTGAATGACAGG + Intronic
1034489790 7:151387105-151387127 TGAGAGGCTCTGTGACTGTCTGG - Intronic
1037025536 8:14031435-14031457 TGAAAGACGCTGTGAATAACTGG - Intergenic
1039869831 8:41536610-41536632 TGAGAGTGCCTGTAAATATCTGG + Intronic
1041383294 8:57274689-57274711 TGTGAGTCTCTGTGATTGGCTGG - Intergenic
1042652575 8:71059648-71059670 TGAAAGTCAGTGTGAAGGACCGG + Intergenic
1043584262 8:81749005-81749027 ATATAGTCCCTGTGAATGATAGG - Intronic
1043764108 8:84107264-84107286 TGTGAATTCCTGTGCATGACCGG + Intergenic
1045188006 8:99857837-99857859 TGAGAGGCCCTATGGATGCCAGG - Intronic
1045377336 8:101587332-101587354 TGAGAGTCTGTTTTAATGACAGG + Intronic
1046668254 8:117029184-117029206 TGATACTACCTGTGAATGAATGG - Intronic
1050395824 9:5195034-5195056 TCAGAGTCCCTGTGCCTGTCCGG + Intergenic
1051536728 9:18167372-18167394 TGAGTGTTCCTTTGAATGACTGG + Intergenic
1053668253 9:40332979-40333001 TGAGAAGCCCTGTGAGTGGCAGG - Intergenic
1053671194 9:40364437-40364459 TGAGTATCCCTGTGATTGACAGG + Intergenic
1053918058 9:42959271-42959293 TGAGAAGCCCTGTGAGTGAAAGG - Intergenic
1053921003 9:42990817-42990839 TGAGTATCCCTGTGATTGACAGG + Intergenic
1054379395 9:64473030-64473052 TGAGAAGCCCTGTGAGTGGCAGG - Intergenic
1054382310 9:64504511-64504533 TGAGTATCCCTGTGATTGACAGG + Intergenic
1054513422 9:66011863-66011885 TGAGTATCCCTGTGATTGACAGG - Intergenic
1054516359 9:66043314-66043336 TGAGAAGCCCTGTGAGTGGCAGG + Intergenic
1057493085 9:95537871-95537893 AGAGGGGCCCTGGGAATGACGGG - Intergenic
1060418027 9:123446505-123446527 TTAGAGTCTCTGTGATTGAAAGG - Intronic
1061307180 9:129738803-129738825 TGTGAGTCCCTGTGATGGCCAGG - Exonic
1062123401 9:134846524-134846546 TGGGAGTCCCCTTGCATGACGGG - Intergenic
1062260638 9:135661273-135661295 TGACCGTACCTGTGAAAGACTGG - Intergenic
1203567989 Un_KI270744v1:108102-108124 TGAGAAGCCCTGTGAATGGAAGG + Intergenic
1203569049 Un_KI270744v1:115089-115111 TGAGAAGCCCTGTGAATGGAAGG + Intergenic
1186961126 X:14737286-14737308 TGAGAGCCCCTGTGAAGTAGAGG + Intergenic
1188262133 X:28034481-28034503 TAAGCGTCCCTGTGCATAACGGG + Intergenic
1189155503 X:38752295-38752317 TGAGAGTAGAGGTGAATGACAGG + Intergenic
1194619433 X:96151199-96151221 TTAGAGTGCCTCTGAAAGACAGG - Intergenic
1201269244 Y:12238551-12238573 TGTGAGTCCTTGTGGATGAAGGG - Intergenic