ID: 1118345498

View in Genome Browser
Species Human (GRCh38)
Location 14:64937825-64937847
Sequence CTTGAGAAGCCCAATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118345498_1118345502 12 Left 1118345498 14:64937825-64937847 CCTTCAGCATTGGGCTTCTCAAG 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1118345502 14:64937860-64937882 TTTGGAAAACTGTCCCTTCAGGG 0: 1
1: 0
2: 1
3: 33
4: 278
1118345498_1118345499 -6 Left 1118345498 14:64937825-64937847 CCTTCAGCATTGGGCTTCTCAAG 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1118345499 14:64937842-64937864 CTCAAGCAGTGTGTCCAGTTTGG 0: 1
1: 0
2: 1
3: 57
4: 497
1118345498_1118345501 11 Left 1118345498 14:64937825-64937847 CCTTCAGCATTGGGCTTCTCAAG 0: 1
1: 0
2: 0
3: 13
4: 211
Right 1118345501 14:64937859-64937881 GTTTGGAAAACTGTCCCTTCAGG 0: 1
1: 0
2: 0
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118345498 Original CRISPR CTTGAGAAGCCCAATGCTGA AGG (reversed) Intronic
900773415 1:4563637-4563659 CATGAGAAGCCCTAGGCTTAGGG - Intergenic
900922828 1:5684522-5684544 TTTGAGAAGCACAGTGTTGAGGG + Intergenic
903405424 1:23091521-23091543 TCTGAGAAGCCCACTTCTGAAGG + Exonic
903831344 1:26177254-26177276 CTTGAGGAGCCCAAGGGTCAGGG + Intergenic
904390868 1:30184999-30185021 CAGGAGAAGCCCAAGGCTGGTGG - Intergenic
904882601 1:33712155-33712177 CCTCAGAAGCCCCAGGCTGATGG - Intronic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
906504789 1:46370911-46370933 CTTGAGAATTCCTTTGCTGAAGG + Intergenic
906654037 1:47534615-47534637 AATGAGGAGCCCGATGCTGAAGG - Intergenic
907089292 1:51709545-51709567 CTGGAGAAGATCAAGGCTGATGG + Intronic
909474999 1:76072660-76072682 CCTGAGACACCCAAGGCTGATGG + Intergenic
910469907 1:87540588-87540610 TTTGAGAAGTCCAAGGTTGAGGG - Intergenic
911125077 1:94333801-94333823 TCTGAGAAGCTCAGTGCTGAAGG - Intergenic
916888551 1:169094558-169094580 TTTGAGAAGCCCATTGCAGTTGG - Intergenic
918106565 1:181420243-181420265 CTGGGTAAGCCAAATGCTGATGG + Intronic
918198371 1:182243917-182243939 CTTGTGAAGCCAAATGCAGAAGG - Intergenic
920136177 1:203771100-203771122 CTCCAAAAGCCCAGTGCTGATGG + Intronic
920645246 1:207798540-207798562 CTTGAGAAGCACGATGCTATGGG - Intergenic
920824321 1:209411342-209411364 CTTGGAAAGCACAATGTTGATGG - Intergenic
922990826 1:229909749-229909771 CTTGAGAAGACTAAAGCTCAAGG - Intergenic
1062821624 10:538396-538418 CTTTGGAAGGCCAAGGCTGAAGG - Intronic
1070212444 10:74339202-74339224 CTTTAGAAGGCCAAGGCAGAAGG - Intronic
1071600815 10:86957976-86957998 TTTGAGCCGCCCAGTGCTGAAGG - Intronic
1073011625 10:100364453-100364475 CTTGAGAATTCCTGTGCTGAAGG - Exonic
1073113654 10:101078392-101078414 CTTGACAAGTCCAATGCCAAGGG + Intergenic
1074893796 10:117757439-117757461 GTTCAGCAGCCCAAGGCTGAGGG - Intergenic
1077438266 11:2555368-2555390 CCTGGGAACCCCACTGCTGATGG - Intronic
1077827931 11:5831025-5831047 CTCAAGAAGCCCAATGCCTAGGG - Intronic
1079266214 11:18935407-18935429 CATGAGAAGCCTAATGGTAATGG + Intronic
1079975253 11:27083252-27083274 CTTGTGTAGCCCAACACTGAAGG - Intronic
1083212559 11:61197269-61197291 CTTGGGAAGGCCAAGGCGGAAGG + Intergenic
1084207237 11:67602712-67602734 CTTGAGAAGCTCTATGCTGGGGG + Intergenic
1084759745 11:71262399-71262421 CTTTAGGAGGCCAAGGCTGAAGG + Intergenic
1085073491 11:73570496-73570518 CTTAAGGAGGCCAAGGCTGATGG + Intronic
1089118747 11:116117211-116117233 ATTGAGGAGCCCAATGGTCATGG - Intergenic
1090422494 11:126585160-126585182 CTTTGGAAGGCCAAGGCTGACGG - Intronic
1090555869 11:127874763-127874785 GCTGAGAAGTCCAATGTTGAGGG - Intergenic
1092075631 12:5671073-5671095 CTTGAGGAGCCCCTTTCTGAGGG - Intronic
1092956046 12:13551182-13551204 CTTGAGAATCCCTATTCTCAAGG - Exonic
1093009688 12:14093607-14093629 GCTGGGAAGCCCAAGGCTGAGGG + Intergenic
1093093280 12:14944594-14944616 ATTGACAAGGCCAATGCTCAGGG - Intronic
1095310778 12:40693737-40693759 CTTGAGAAGGCCAAGGCAGCCGG - Intronic
1096266563 12:50127623-50127645 CTTGAGGAGGCCAAGGCAGAAGG - Intergenic
1100057103 12:90525069-90525091 CATGAGAAACCCAAGGCAGAGGG - Intergenic
1100849184 12:98691456-98691478 CTTAAGAAGCCCAGTCATGAAGG - Intronic
1100991330 12:100254568-100254590 CTTTGGAAGCCCAAGGCAGATGG - Intronic
1103265898 12:119629815-119629837 GATGAGAAGGCCAATGATGATGG - Exonic
1103636246 12:122308383-122308405 CTGGAGATGCCAAATGCTGTAGG + Intronic
1104498893 12:129266092-129266114 CTTGTGAAGGCCACTGATGATGG + Intronic
1105328526 13:19392576-19392598 CTGGAAAAGACCAATGGTGATGG - Intergenic
1115057465 14:29147514-29147536 GTTGAGAAGCACTATTCTGAAGG + Intergenic
1115347487 14:32358787-32358809 CATGAGAAGCCTACTGCTAAGGG + Intronic
1118345498 14:64937825-64937847 CTTGAGAAGCCCAATGCTGAAGG - Intronic
1119741704 14:77017964-77017986 ACTGAGAAGCCCCAAGCTGAAGG + Intergenic
1119911140 14:78350374-78350396 ATTGCTGAGCCCAATGCTGAAGG + Intronic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1121969627 14:98344364-98344386 CTTGAGAAGCTCTGTGCTAAAGG + Intergenic
1124724989 15:32148673-32148695 ATTCAGAAGCCCAATCCTTATGG - Intronic
1125694518 15:41624007-41624029 CTTCAGAAGGCCAAGGCTGGAGG - Intronic
1126059762 15:44769033-44769055 TTTTAGAGGGCCAATGCTGAAGG - Intergenic
1126922213 15:53540827-53540849 CTTGGGAAGCCCAACGGTCAGGG + Intronic
1128274288 15:66339622-66339644 CTTTGGAAGCCCAATGCTGGAGG + Intronic
1132785758 16:1656324-1656346 CTTGAGAAGACCCCTGCAGAAGG + Exonic
1132838624 16:1967332-1967354 CTTGAGAACCCCATGGCAGACGG - Exonic
1134399308 16:13894073-13894095 ATTGAGAAGCCCAATCCTTCAGG + Intergenic
1135800752 16:25492837-25492859 CTGCAGAAGCCCAATGCCAAGGG - Intergenic
1136394189 16:29983980-29984002 CTGGGGAAGCCCAGTGCTGGGGG + Intronic
1136562818 16:31050759-31050781 CTTTAGAAGGCCAAAGCTGGCGG - Intergenic
1137384702 16:48030604-48030626 TCTGAGATGCCCAATGCAGAGGG - Intergenic
1140675908 16:77329344-77329366 CTTGGGAAGGCCAAGGCAGAAGG - Intronic
1141436481 16:84002548-84002570 CTGGTGAAGCCCAAGGTTGAAGG + Exonic
1142308005 16:89296281-89296303 CTTGAAAAGCCCTCTGCTGCCGG + Intronic
1142823498 17:2491966-2491988 CTTTAGGAGGCCAAGGCTGACGG + Intronic
1144777113 17:17790354-17790376 CACGAGAAGCCCAGTGCTGATGG - Intronic
1144797461 17:17901938-17901960 CTTTAGAAGCCCAAGGCAGGTGG + Intronic
1145185366 17:20789244-20789266 CTTGAGAATCCCTGTGCTGAAGG - Intergenic
1147374310 17:40015012-40015034 CTTGAGAATCCCAAAGGAGAGGG + Intergenic
1147381865 17:40061082-40061104 CTTGAGCAGCCCAATCCCAAGGG + Intronic
1149494265 17:57107089-57107111 CTTCAGCACCCCATTGCTGAAGG - Exonic
1150803473 17:68300525-68300547 CTTGAGAAGAAAAATCCTGAGGG - Intronic
1151453259 17:74212188-74212210 CTGCAGGAGCCCAAAGCTGAGGG - Intergenic
1151957145 17:77386109-77386131 CGTGGGAAGCCCACAGCTGAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153709374 18:7782516-7782538 CTGGAGAAGGACAATGGTGATGG - Intronic
1154503957 18:15015605-15015627 TTTAAGAAGTCCACTGCTGATGG + Intergenic
1155648114 18:28106171-28106193 CTTGGGGAGCCCAAGGCTGGTGG + Intronic
1156887390 18:42151095-42151117 TTTGCGAAGCCCCATGATGATGG - Intergenic
1157974140 18:52306829-52306851 CTTGAGAAGAATAAAGCTGAAGG + Intergenic
1158060541 18:53335286-53335308 CTTGATAAGTGCTATGCTGATGG - Intronic
1160128238 18:76199207-76199229 GCTGAGAAGTCCAAGGCTGAGGG - Intergenic
1160675818 19:390764-390786 CATCAGCAGCCGAATGCTGAGGG + Intergenic
1161087992 19:2343943-2343965 CCTGCGAAGCCCACGGCTGAGGG - Exonic
1161473756 19:4473558-4473580 CTGGAGAAGCCCAGTTTTGAGGG + Intronic
1162115006 19:8423754-8423776 CTTTGGAAGTCCAAGGCTGAAGG + Intronic
1162330578 19:10026764-10026786 CTTTAGGAGGCCAAGGCTGAAGG - Intergenic
1163597364 19:18227827-18227849 CTGGAGAAGCCCATTGATCAGGG + Intronic
1164955995 19:32385569-32385591 CTTTAGAAGGCCAAGGCTGGAGG + Exonic
1167977906 19:53246073-53246095 CTTCAGAAGGCCAAGGCGGATGG + Intronic
928124992 2:28609161-28609183 CTTTGGAAGGCCAAGGCTGATGG - Intronic
929953235 2:46433533-46433555 CTTGAGAAGAGAAATGCTGGTGG + Intronic
931327992 2:61247941-61247963 CTTGAGGAGGCCAATGCAGGTGG + Intronic
931523149 2:63121611-63121633 CTTTAGGAGGCCAAGGCTGAAGG - Exonic
931824078 2:65981185-65981207 CTTGAGATTCCCAAGGCTAAGGG - Intergenic
931900834 2:66785960-66785982 CTTGAGGAGCCCACTGCTTACGG - Intergenic
932104948 2:68933688-68933710 CTGCAGAAACCCAATACTGAGGG - Intergenic
936081191 2:109433847-109433869 CTTGAGAAGCAAACTGCAGAGGG + Intronic
936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG + Intronic
937089487 2:119196396-119196418 CATGAGCAGCCCCATGATGAGGG - Intergenic
937313696 2:120917685-120917707 CAGGAGAAGCCCAAGGCAGAAGG - Intronic
939873986 2:147555735-147555757 TTTGAGAAGCCCATTGATTATGG + Intergenic
942475454 2:176315059-176315081 TTTGAGAAGCCCAATCCTCAAGG - Intronic
943212596 2:184987448-184987470 CCTGAGAAGTCCAAGGCTTAAGG - Intergenic
944880943 2:204012461-204012483 CTTTAGTAGCCTAATACTGAAGG - Intergenic
945158182 2:206860967-206860989 GCTGAGAAGTCCAAGGCTGAGGG - Intergenic
946089346 2:217207113-217207135 CTGGAGAAGGCCCATGCTCAGGG + Intergenic
947014086 2:225598878-225598900 CTGGAGAAGCCTCATGCTGCAGG - Intronic
947315771 2:228856358-228856380 CTTTAGAAGGCCAAGGCTGGAGG - Intronic
948160782 2:235822401-235822423 CTGGAGAAGCCCAGGGGTGAGGG + Intronic
1168932857 20:1638059-1638081 CTAGGGATGCCCAATGCTGCTGG - Intronic
1172652350 20:36512814-36512836 CTTGACATGCGCAAGGCTGAGGG + Intronic
1176253121 20:64136061-64136083 TTTGTGAAGCACAAAGCTGAGGG - Intergenic
1177380181 21:20330772-20330794 ACTGAGAAGCCCAAGGCTGAGGG + Intergenic
1181088901 22:20458688-20458710 CCTGAGAAGACCACTCCTGATGG - Intronic
1183848916 22:40566586-40566608 TTTGGGAGGCCCAAGGCTGATGG + Intronic
1183911865 22:41085841-41085863 CTTTAGGAGGCCAATGCTGGAGG - Intergenic
1184007032 22:41717857-41717879 CTTGGGAAGGCCAAGGCAGAAGG - Intronic
1184045704 22:41971182-41971204 CCTGAGATGCCCCATGCTGGAGG + Intergenic
1184268429 22:43363431-43363453 TTAGAGAAGCCCAAAGCTGGCGG + Intergenic
949443358 3:4107707-4107729 CTTTGGAAGGCCAAGGCTGAAGG + Intronic
951317631 3:21205646-21205668 CTGGAGATGCCCAAAGCTGTGGG + Intergenic
951529694 3:23686828-23686850 CTTCAGAAGCAAAGTGCTGAGGG - Intergenic
952240159 3:31523808-31523830 TGTGAGAAGCCCATTTCTGAGGG - Intergenic
952869965 3:37890081-37890103 CATGAGAAGCCCAGTGGTGTAGG + Intronic
953413307 3:42702058-42702080 ACTGAGAAACCCAATCCTGAAGG - Intronic
953492307 3:43362510-43362532 CCTGAGAAGCCACATGGTGATGG - Intronic
954896896 3:53983074-53983096 AAAGAGAAGCCCAAGGCTGAAGG - Intergenic
958638500 3:96776640-96776662 CTTGAGTATGCCAATCCTGAAGG - Intergenic
960026124 3:113012561-113012583 ATTGGGAAGCCGAGTGCTGATGG - Intronic
960880910 3:122344106-122344128 GCTGAGAAGTCCAAAGCTGAGGG + Intergenic
961053615 3:123767969-123767991 CTTCAGAAGCCAAGTGGTGATGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961723341 3:128910115-128910137 GTTGCGGAGCCCAATGCGGATGG - Exonic
962618603 3:137153224-137153246 CTTCAGAGGCCCAGTGCTGCAGG + Intergenic
962932029 3:140047607-140047629 GCTGAGAAGCCCAAGGTTGAGGG + Intronic
968382133 4:106199-106221 CTTTAGAGGGCCATTGCTGAGGG + Intergenic
968498849 4:934699-934721 CTTGAGCAGCCTAAAGCGGATGG + Intronic
969427889 4:7136538-7136560 GTCGAGAAGCCCAGTTCTGAAGG - Intergenic
970604071 4:17663178-17663200 CTTTAGAAGGCCAAGGCTGGTGG - Intronic
973881710 4:55279388-55279410 GCTGAGAAGTCCAAGGCTGAGGG - Intergenic
976141203 4:81993828-81993850 CTGGTGTAGACCAATGCTGAAGG - Intronic
976288527 4:83393543-83393565 CTTTAGAAGGCCAAGGCTGGAGG - Intergenic
978611170 4:110541964-110541986 TTTTAGAAGCCCAAGGCTGAAGG - Intronic
978659680 4:111109336-111109358 GCTGAGAAGCTCAATACTGAGGG - Intergenic
980640875 4:135577430-135577452 CTTTAGAAGGCCAAGGATGAAGG + Intergenic
982529882 4:156526421-156526443 ATGGCAAAGCCCAATGCTGAGGG + Intergenic
983080569 4:163380522-163380544 CTTAATAAGCCAAATTCTGAGGG - Intergenic
983269521 4:165544822-165544844 CTTGAGAAAGACAATGTTGATGG + Intergenic
986853274 5:11837987-11838009 CTGGTGATGCCCCATGCTGAAGG - Intronic
988789521 5:34594385-34594407 GCTGAGAAGCCCAAGGTTGAGGG - Intergenic
989053054 5:37340195-37340217 CTTTAGGAGGCCAATGCAGACGG + Intronic
992192255 5:74304744-74304766 CTTGGGAATCCCTCTGCTGAGGG - Intergenic
994029748 5:95128095-95128117 CTTGAGGAGCAAAATGCTAAAGG + Intronic
995991662 5:118247311-118247333 CTTGAGACCCCGAGTGCTGAGGG - Intergenic
996664487 5:126043037-126043059 CTTCTGAAGCCAAAGGCTGAGGG + Intergenic
996756124 5:126937022-126937044 GTTGAGAGACCCAAAGCTGAGGG - Intronic
998159176 5:139803488-139803510 CTTGAGAAGACAAATGCTCTTGG + Intronic
998714381 5:144866049-144866071 CTTAAGAAACCCATTTCTGAGGG + Intergenic
999718447 5:154380714-154380736 CCTTAAAAGCCCAATGCAGAGGG + Intronic
1000951807 5:167493167-167493189 CTTTAGAAGGCCAAAGCAGAAGG + Intronic
1001141202 5:169145413-169145435 CTAGAGATGCCCAAAGCTGCAGG + Intronic
1003968611 6:11277607-11277629 CTTGAGAATCTCAGGGCTGAGGG - Intronic
1004015682 6:11729715-11729737 CTTAAAAATTCCAATGCTGAGGG + Intronic
1004519133 6:16345878-16345900 GTTTGGCAGCCCAATGCTGAAGG - Intronic
1005250033 6:23934811-23934833 ATTGTAAAGCCCAATGCTGGAGG - Intergenic
1005690502 6:28300384-28300406 ATTGAGAAGACCTATGCAGAGGG - Intronic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1007567314 6:42862091-42862113 CTTGAGGAGGCCAAGGCGGATGG + Intronic
1007713435 6:43839069-43839091 CTTGAGGAGCCCCAGTCTGAGGG + Intergenic
1012433832 6:99193617-99193639 CTTAAGTTGCCCAATGATGAGGG + Intergenic
1013054330 6:106568616-106568638 CTTAAAAAGGACAATGCTGATGG + Exonic
1015975275 6:138784128-138784150 CTTGGGGAGGCCAAGGCTGACGG - Intronic
1015985696 6:138882070-138882092 CTTAGAAAGCCCAAGGCTGAGGG + Intronic
1017056875 6:150444531-150444553 CTTGAGAAGCACAGAGCTGGGGG + Intergenic
1017478711 6:154827735-154827757 CTTGAGAAGCAAAATGCTGTAGG + Intronic
1018616325 6:165690328-165690350 GATGAGCAGCCCAAAGCTGAAGG - Intronic
1020740405 7:12009234-12009256 CTTCAGAAGTCTAATGCTGTGGG - Intergenic
1021482425 7:21132546-21132568 CTTAGGAAGCCCAAAGGTGAAGG + Intergenic
1022619977 7:31972972-31972994 CTTGGGCTGCCCAGTGCTGATGG - Intronic
1022909437 7:34885978-34886000 CCTGAGAAGACTAATGCAGATGG + Intergenic
1023729406 7:43176466-43176488 GTTGGGAAGCCCAAAGTTGAGGG + Intronic
1023905218 7:44517003-44517025 CTTCAGAAGGAGAATGCTGAGGG + Intronic
1026356589 7:69563128-69563150 CCCCAGAAACCCAATGCTGATGG + Intergenic
1032953807 7:136947730-136947752 CTTGAGAAGGCTAGTGTTGATGG + Intronic
1034054479 7:148020028-148020050 CTTTGGAAGGCCAAGGCTGATGG - Intronic
1034340227 7:150348092-150348114 GTTGGGAAGTCCAAGGCTGAAGG - Intergenic
1036713916 8:11102422-11102444 CTTGAGAAGCACAGTGCAGCTGG - Intronic
1036801833 8:11798301-11798323 CTTGGGAAGACCAATGCAGGCGG - Intronic
1038635129 8:29280205-29280227 CTTTAGAAGGCCAAGGCTGGAGG + Intergenic
1042353651 8:67802972-67802994 CTTGAGGAGGCCAAGGCAGATGG - Intergenic
1044177630 8:89148815-89148837 CTTTCTAAGCCCCATGCTGAAGG + Intergenic
1044363279 8:91313417-91313439 CTTGAGAAGAACAAAGCTGAAGG - Intronic
1046008430 8:108514752-108514774 CCTGAGAATCCCAATGTTTATGG - Intergenic
1048061338 8:130922155-130922177 GCTGAGAAGTCCAAGGCTGAGGG - Intronic
1048160837 8:132019679-132019701 CTTGAGAAGAACAAAGCTGGAGG + Intergenic
1049013408 8:139903247-139903269 CTGGAGAAGCCCAAGGCAAATGG - Intronic
1049999410 9:1060548-1060570 CCTGAGAATCCCGATGCTGCTGG + Intergenic
1051813699 9:21079370-21079392 CTTGACAAGCTCCCTGCTGATGG - Intergenic
1052761157 9:32592976-32592998 CTTGAGAAAACCAAAGATGAGGG + Intergenic
1054795950 9:69302175-69302197 CTTGAGAAGTGCCATGCTCAAGG - Intergenic
1054870872 9:70046103-70046125 TTTGAGAAGCCCCGTGCTGGAGG - Intronic
1055505502 9:76944221-76944243 CTTGAGAAGAGCAATGTTGGTGG - Intergenic
1058813550 9:108663837-108663859 CTTAACAAGCTGAATGCTGAAGG + Intergenic
1060341757 9:122783517-122783539 CTTGAGAAGCACAGTGGAGAGGG + Intergenic
1060508436 9:124215340-124215362 CTTGAGGAGCCCATGGCTGGTGG - Intergenic
1185659642 X:1717094-1717116 CCTTTGAAGCCCAATGCAGAGGG - Intergenic
1186114622 X:6292503-6292525 CAGGAGAAGCCAAAAGCTGAGGG - Intergenic
1188059396 X:25582411-25582433 TTTGAGAGGCCCAGTGATGAAGG + Intergenic
1190010679 X:46781958-46781980 CTTTAGAAGGCCAAGGCTGGAGG + Intergenic
1193265724 X:79466249-79466271 TTTGAGAAAACAAATGCTGAGGG + Intergenic
1194071971 X:89336746-89336768 CTTGAGAAGAACAAAGCTGGAGG + Intergenic
1194983531 X:100465334-100465356 CTTGATAAGCACGATGCTGAAGG - Intergenic
1195485189 X:105396662-105396684 CTTGATAAGACCAATACTTAAGG + Intronic
1195796593 X:108655111-108655133 CTTGAGAAGCCAAGTGCCTAAGG - Intronic
1197504596 X:127285998-127286020 CATGAGAAGCCCAAAGTAGATGG + Intergenic
1200726214 Y:6672478-6672500 CTTGAGAAGAACAAAGCTGGAGG + Intergenic