ID: 1118347096

View in Genome Browser
Species Human (GRCh38)
Location 14:64948329-64948351
Sequence TCGTGTGGGGTGCCCCACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 54}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118347083_1118347096 14 Left 1118347083 14:64948292-64948314 CCTGTCTGCCCACGGGCCTCCTG 0: 1
1: 0
2: 1
3: 34
4: 273
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347092_1118347096 -5 Left 1118347092 14:64948311-64948333 CCTGAGGGAAGAGGGGTGTCGTG 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347081_1118347096 16 Left 1118347081 14:64948290-64948312 CCCCTGTCTGCCCACGGGCCTCC 0: 1
1: 0
2: 7
3: 30
4: 336
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347082_1118347096 15 Left 1118347082 14:64948291-64948313 CCCTGTCTGCCCACGGGCCTCCT 0: 1
1: 1
2: 0
3: 28
4: 239
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347087_1118347096 5 Left 1118347087 14:64948301-64948323 CCACGGGCCTCCTGAGGGAAGAG 0: 1
1: 0
2: 0
3: 27
4: 236
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347077_1118347096 23 Left 1118347077 14:64948283-64948305 CCCGGCTCCCCTGTCTGCCCACG 0: 1
1: 0
2: 3
3: 49
4: 365
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347076_1118347096 24 Left 1118347076 14:64948282-64948304 CCCCGGCTCCCCTGTCTGCCCAC 0: 1
1: 1
2: 3
3: 54
4: 447
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347086_1118347096 6 Left 1118347086 14:64948300-64948322 CCCACGGGCCTCCTGAGGGAAGA 0: 1
1: 0
2: 3
3: 19
4: 121
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347078_1118347096 22 Left 1118347078 14:64948284-64948306 CCGGCTCCCCTGTCTGCCCACGG 0: 1
1: 0
2: 2
3: 32
4: 369
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54
1118347091_1118347096 -2 Left 1118347091 14:64948308-64948330 CCTCCTGAGGGAAGAGGGGTGTC 0: 1
1: 0
2: 2
3: 17
4: 185
Right 1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG 0: 1
1: 0
2: 2
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118347096 Original CRISPR TCGTGTGGGGTGCCCCACAC AGG Exonic
901782438 1:11602743-11602765 TCTTGTGGGGTGACCCACACTGG + Intergenic
903025502 1:20427313-20427335 TGGTGTGGGGTGGCCCTAACTGG - Intergenic
916143566 1:161721193-161721215 TCATGTGGGAAGCCACACACTGG + Intergenic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
923092221 1:230749384-230749406 TCGTGGGCGGTGCCCCTCAGAGG - Intronic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1076062622 10:127425648-127425670 TGGTGTAGGGCGCACCACACTGG + Intronic
1077131142 11:973300-973322 TGGTGTGGGGTGCAGCACCCTGG - Intronic
1085467940 11:76736919-76736941 GCCTGTGGGGTGCCCCACACTGG - Intergenic
1087681614 11:101224564-101224586 TTGCTTGGGGTGGCCCACACGGG + Intergenic
1091025459 11:132137216-132137238 TAGTATGGGGTGACACACACTGG + Intronic
1091152039 11:133337996-133338018 TCTTGTGTTGTGCCCAACACAGG - Intronic
1092389953 12:8067936-8067958 CCGGGTGGGGTGGCTCACACCGG - Intergenic
1103781617 12:123402557-123402579 TGGTTTGGGGTGAGCCACACTGG + Intronic
1105034378 12:132908315-132908337 TCGTGTGGGGCGGCCGACCCCGG - Intronic
1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG + Exonic
1202942253 14_KI270725v1_random:162195-162217 TCCTGTAGGGTGGCCCACCCAGG - Intergenic
1124823285 15:33068698-33068720 TCGTGTGGGTTATCCCTCACGGG - Intronic
1129111827 15:73341636-73341658 TAGTGTGGGCTGTCCCACCCCGG - Intronic
1129266407 15:74395777-74395799 TCATGTGGGCAGCCCCCCACTGG + Intergenic
1135700766 16:24630686-24630708 TGCTGTAGGGAGCCCCACACTGG + Intergenic
1139355768 16:66366430-66366452 TCAAGTGGGGTGCCCCAGGCAGG + Intergenic
1142173161 16:88633385-88633407 TAGCTTGAGGTGCCCCACACTGG - Intergenic
1144028508 17:11299759-11299781 TTGTGTGGGTAGGCCCACACGGG - Intronic
1150888857 17:69121414-69121436 TGGGGTGAGGTGCCCCACAATGG + Intronic
1151693932 17:75704499-75704521 TCCTGTGGACTGCCACACACGGG - Intronic
1151789721 17:76297227-76297249 CCGGGTGTGGTGTCCCACACCGG + Intronic
1160510290 18:79449740-79449762 GTGTGTGGGGTGCCCCATCCAGG + Intronic
1167062655 19:47159834-47159856 TCGAGTGTGGTGGCACACACTGG - Intronic
1168567299 19:57435702-57435724 TTGTGTGGGGTGCCCGGGACTGG + Intronic
927458195 2:23275468-23275490 CCGTGTGGGCTGCCCCACTCAGG - Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
1173748078 20:45453371-45453393 CCTTGTGAGGTGCCCCTCACTGG + Intergenic
1176120662 20:63453155-63453177 TCTCCTGGGGTGCCCGACACAGG - Intronic
1176219189 20:63962033-63962055 TGGTGTGGGGTGCCCACCAGAGG - Intronic
1181494627 22:23281031-23281053 TCGTGCGTGGAACCCCACACAGG - Intronic
1184332529 22:43835195-43835217 TGGTGTGGGGTGGGGCACACAGG + Intronic
1184673648 22:46028531-46028553 TCGTGCAGAGTGACCCACACTGG - Intergenic
1184889674 22:47372081-47372103 TAGTGTGTGGAGCCCCAAACAGG + Intergenic
955939830 3:64137333-64137355 TCGTGATGGGTTCCCCAGACTGG - Intronic
961505603 3:127368906-127368928 CAGTGTGGGGTGCACCACGCAGG + Intergenic
984979842 4:185269769-185269791 TCCTGTGGTGTTGCCCACACTGG + Intronic
985552669 5:541397-541419 TCACGTGGGGTGCCCCGGACAGG + Intergenic
985784692 5:1887541-1887563 CCGTTTGGGCTGCCCCACCCAGG + Intergenic
999687611 5:154116951-154116973 TAGTGTGGGCTGCCCCTCTCTGG - Intronic
1002827708 6:788227-788249 GCTTGTGGGGTGCCCCCCACAGG + Intergenic
1002904506 6:1437983-1438005 CCGTGCTGGGTGCCTCACACCGG + Intergenic
1019159494 6:170059593-170059615 TGGTTTGTGGTGCCCCAAACAGG - Intergenic
1019309534 7:353383-353405 TGGTGAGTGGTGCCCCACTCAGG - Intergenic
1020115378 7:5473272-5473294 TCATGTGAGGGGCCCCACCCTGG + Intronic
1026946862 7:74321912-74321934 TCGTGTTAAGTGCCCCAGACAGG + Intronic
1035726754 8:1829519-1829541 TCGTGTGGGCTGCTTCCCACGGG - Intronic
1038710183 8:29936758-29936780 TCATAGGGAGTGCCCCACACAGG + Intergenic
1049108392 8:140627858-140627880 GCGTGTTGGGTGTCCCACAGTGG - Intronic
1060995046 9:127871169-127871191 GTGTGTGGGGTGCCCCATCCTGG + Intronic
1061009342 9:127945958-127945980 TTGGGTGGGGTGCCCACCACAGG + Intronic
1062193905 9:135262910-135262932 TCCTGTGGGGTTGCCGACACTGG - Intergenic
1062270600 9:135706600-135706622 TCTTGTGGAGTGCCCCAGAGTGG - Intronic
1062276759 9:135735025-135735047 TCCTGTGGAGTGCCCCAGAACGG - Intronic