ID: 1118348073

View in Genome Browser
Species Human (GRCh38)
Location 14:64954230-64954252
Sequence AAGAGTGAAGAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3725
Summary {0: 1, 1: 2, 2: 32, 3: 367, 4: 3323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118348067_1118348073 8 Left 1118348067 14:64954199-64954221 CCTGGCAGCCATTCTTCCATGTG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG 0: 1
1: 2
2: 32
3: 367
4: 3323
1118348066_1118348073 22 Left 1118348066 14:64954185-64954207 CCAAATGGGCAATGCCTGGCAGC 0: 1
1: 0
2: 0
3: 18
4: 360
Right 1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG 0: 1
1: 2
2: 32
3: 367
4: 3323
1118348068_1118348073 0 Left 1118348068 14:64954207-64954229 CCATTCTTCCATGTGTGCAGAGA 0: 1
1: 0
2: 4
3: 31
4: 357
Right 1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG 0: 1
1: 2
2: 32
3: 367
4: 3323
1118348069_1118348073 -8 Left 1118348069 14:64954215-64954237 CCATGTGTGCAGAGAAAGAGTGA 0: 1
1: 0
2: 2
3: 19
4: 220
Right 1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG 0: 1
1: 2
2: 32
3: 367
4: 3323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118348073 Original CRISPR AAGAGTGAAGAGAAGGAGGG AGG Intronic
Too many off-targets to display for this crispr