ID: 1118351090

View in Genome Browser
Species Human (GRCh38)
Location 14:64972643-64972665
Sequence CCGTGGCACCCTGCATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 128}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118351075_1118351090 18 Left 1118351075 14:64972602-64972624 CCCATATCCCACCCCAAGTCTGG 0: 1
1: 0
2: 3
3: 12
4: 151
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351074_1118351090 19 Left 1118351074 14:64972601-64972623 CCCCATATCCCACCCCAAGTCTG 0: 1
1: 1
2: 1
3: 28
4: 253
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351081_1118351090 7 Left 1118351081 14:64972613-64972635 CCCCAAGTCTGGCGCCGGTAATT 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351073_1118351090 27 Left 1118351073 14:64972593-64972615 CCACTTCTCCCCATATCCCACCC 0: 2
1: 0
2: 9
3: 90
4: 857
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351079_1118351090 11 Left 1118351079 14:64972609-64972631 CCCACCCCAAGTCTGGCGCCGGT 0: 1
1: 0
2: 2
3: 30
4: 934
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351083_1118351090 5 Left 1118351083 14:64972615-64972637 CCAAGTCTGGCGCCGGTAATTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351085_1118351090 -7 Left 1118351085 14:64972627-64972649 CCGGTAATTCCGCCCGCCGTGGC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351082_1118351090 6 Left 1118351082 14:64972614-64972636 CCCAAGTCTGGCGCCGGTAATTC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351080_1118351090 10 Left 1118351080 14:64972610-64972632 CCACCCCAAGTCTGGCGCCGGTA 0: 1
1: 0
2: 1
3: 0
4: 77
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128
1118351077_1118351090 17 Left 1118351077 14:64972603-64972625 CCATATCCCACCCCAAGTCTGGC 0: 1
1: 0
2: 1
3: 22
4: 223
Right 1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG 0: 1
1: 1
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118351090 Original CRISPR CCGTGGCACCCTGCATCTGC AGG Intronic
900905800 1:5556496-5556518 CCATGGCTCCCAGCATCTGAAGG - Intergenic
903157123 1:21453463-21453485 CTGTGGCACCCATCCTCTGCAGG + Intronic
903361538 1:22780284-22780306 ACATGGCTCCCTGCAGCTGCTGG + Intronic
905010614 1:34744657-34744679 CCTTGGGACCCCGCACCTGCTGG - Intronic
905569483 1:38991940-38991962 CCATGGCCCACTGGATCTGCAGG - Intronic
906057934 1:42930655-42930677 CCTGGGCACCCTGCACCAGCTGG - Exonic
906480158 1:46194386-46194408 CAGTGGCACTCTGCCTCTGAGGG + Exonic
907847072 1:58218582-58218604 CTGTGGGTACCTGCATCTGCTGG + Intronic
911565990 1:99464101-99464123 CCGTGACACCCAGCAACTACAGG + Intergenic
919796194 1:201322865-201322887 CCTGGGCCCCCTGCCTCTGCAGG + Intronic
920351071 1:205338418-205338440 CCTTGGCACTTTGCATATGCAGG - Intronic
920769062 1:208863355-208863377 CCGAAGCACCATGTATCTGCTGG - Intergenic
921128030 1:212195491-212195513 CTCTTGCACTCTGCATCTGCAGG - Intergenic
922168421 1:223135111-223135133 CCAATGCACCCTGCAGCTGCTGG + Intronic
924425023 1:243942909-243942931 GCGTGGCATTCTGAATCTGCAGG - Intergenic
1065789902 10:29250960-29250982 ACGAGGAACCCTGCCTCTGCAGG - Intergenic
1067286537 10:44911503-44911525 CCCTGGCACCATGCAGCTCCAGG + Exonic
1067469921 10:46528629-46528651 CAGGGTCACCCTGCAGCTGCAGG - Intergenic
1069708912 10:70476838-70476860 CCGTGGATCCCAGCATCTGCTGG + Intergenic
1070441221 10:76445446-76445468 CCGTGATGCCCTGCATCTGCAGG - Intronic
1070736364 10:78866282-78866304 CCGTGCCACCCAGCATCTTAGGG + Intergenic
1070801441 10:79246641-79246663 CCGTGTCACAGAGCATCTGCTGG + Intronic
1072794096 10:98341154-98341176 CCCTGGCACACTGCCTGTGCTGG - Intergenic
1076911624 10:133392951-133392973 CCATGGCACCCAGCCTCTACTGG - Intronic
1077423458 11:2463576-2463598 CCTGGGCACCCTGCCTCTTCCGG + Intronic
1078266642 11:9759852-9759874 CAGTGGCACGCGGCATCTGTGGG - Intergenic
1078541696 11:12218260-12218282 CCCTGGGCCCCTGCCTCTGCTGG + Intronic
1078670219 11:13357822-13357844 CAGTGTCACCCTGCCTCAGCGGG + Intronic
1081613166 11:44575574-44575596 CCAGGGGACGCTGCATCTGCTGG + Intronic
1083424500 11:62576092-62576114 CCTTGGCCCCCTGAATCTCCAGG - Exonic
1083623089 11:64058585-64058607 CCGCTGCACCCGGCAGCTGCCGG - Intronic
1090024973 11:123159711-123159733 CTGTGGCACCTTGAGTCTGCAGG + Intronic
1090049236 11:123362831-123362853 CCGGGGCAGCCTGTATCTCCAGG - Intergenic
1090397336 11:126427693-126427715 CGGTGGCTCCCCACATCTGCTGG - Intronic
1091621688 12:2093834-2093856 CCCTGGCAGCCTGCAACTGCAGG - Intronic
1091644849 12:2265607-2265629 CAGCGTCACCCTGCATTTGCAGG - Intronic
1093311446 12:17591516-17591538 CCGTGGCACAGTGCAAGTGCTGG + Intergenic
1095133497 12:38571047-38571069 CCCTGACACCCTGCAACCGCTGG + Intergenic
1102222170 12:111201986-111202008 CCTTGGCCCACTGCATCTTCTGG - Intronic
1104647851 12:130509657-130509679 CCATGGCCCCCGGCCTCTGCTGG + Intronic
1105291913 13:19058732-19058754 CCGTGGCACCCTGTCTCTGTGGG - Intergenic
1108163511 13:47667509-47667531 CGGTGCCACTCTGCATCTGTGGG - Intergenic
1112439522 13:99415884-99415906 CTGTGGCTCCCTGCCTCAGCCGG + Intergenic
1116821909 14:49634648-49634670 CCGTGGCGTCCAGCATCTGGCGG + Exonic
1117144379 14:52822421-52822443 TGGTGGCACCCTGAATCTACTGG - Intergenic
1117783587 14:59259404-59259426 CCGTAGGACCCTGCATGAGCTGG + Intronic
1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG + Intronic
1119200164 14:72746359-72746381 CCATGCCAGCCTGCAGCTGCGGG - Intronic
1119414324 14:74459607-74459629 GCTTGGTACCCTGCATCTTCAGG + Intergenic
1121803500 14:96795083-96795105 CCCTGGCACCCTTGATCTGATGG - Intergenic
1122504109 14:102220841-102220863 TCATTGCACCCTGCATCTCCTGG + Intronic
1124646813 15:31442746-31442768 CCCTGTCTCCCTCCATCTGCTGG - Intergenic
1125504214 15:40257692-40257714 TAGTGCCACCCTGCATCTGTGGG + Intronic
1126694666 15:51315731-51315753 CCTTGGCACCCAGAATCTGCAGG - Intronic
1130042664 15:80418216-80418238 CCCTGGCACTCTGAGTCTGCTGG + Intronic
1134799468 16:17071292-17071314 CCGAGGCACCCAGCATTTCCAGG - Intergenic
1135766170 16:25179463-25179485 CAGTGCCACCCTGCACATGCAGG - Intergenic
1135949559 16:26901393-26901415 CCTTGGCACCTTGCATCTGCCGG - Intergenic
1136227110 16:28866592-28866614 CCGTGGCATCCTGCAGTGGCGGG + Exonic
1138033660 16:53580653-53580675 CCGTGCCACCCTGCTGCAGCCGG + Intergenic
1142969356 17:3600984-3601006 CCCTGCCTCCCTGAATCTGCAGG + Intergenic
1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG + Intergenic
1150379306 17:64708173-64708195 CAGTGGCACCCTTCACCTCCTGG + Intergenic
1150856299 17:68756454-68756476 CCCACTCACCCTGCATCTGCCGG - Intergenic
1151516391 17:74598930-74598952 CCCCACCACCCTGCATCTGCAGG - Intergenic
1160493213 18:79355011-79355033 GCGATGCACCCGGCATCTGCAGG + Intronic
1160755541 19:755147-755169 CTGTGGCTCCTGGCATCTGCAGG - Intronic
1160861716 19:1240021-1240043 CCGTGGCTCCCTACATCCGGAGG - Intergenic
1161920190 19:7260297-7260319 CCCTGGCACCCAGCATGTCCCGG + Intronic
1162570151 19:11466809-11466831 CCATGGCCCCCAGTATCTGCTGG + Exonic
1162895979 19:13764864-13764886 CCGGGGCGCCCCGCACCTGCGGG - Exonic
1164464754 19:28478045-28478067 CAATGGCACCCTGCATTTGATGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1168629920 19:57948576-57948598 CGGAGGCACCCTGCAGCAGCAGG + Intergenic
927097340 2:19757548-19757570 CCTGGGCATCCTGCATCTGAGGG + Intergenic
927868912 2:26611056-26611078 CCGTGAATCCCTGCATTTGCTGG + Intronic
932201221 2:69829943-69829965 CCCTGGCACCCTGCGCCTGCTGG - Exonic
932430935 2:71673132-71673154 ACTTGGCACCCACCATCTGCAGG + Intronic
937081670 2:119144778-119144800 CCCTGGTCCCCTGCAGCTGCTGG + Intergenic
937679345 2:124627086-124627108 CCCTGAGACCCAGCATCTGCGGG + Intronic
943152258 2:184129716-184129738 CTGTTGCCCCCTGAATCTGCTGG + Intergenic
945302562 2:208227899-208227921 CTGGGGCACCCAGCAGCTGCTGG + Intergenic
946374913 2:219302246-219302268 CCTTGGCACCCTGGCCCTGCTGG + Exonic
947825894 2:233105784-233105806 CCCTGGCACCCTCCACTTGCTGG - Intronic
948823215 2:240560691-240560713 CCGCGGCGCCCAGCTTCTGCCGG - Exonic
948957262 2:241303248-241303270 GAGTGGCACCCTGCACCAGCAGG - Intronic
1169340968 20:4795879-4795901 CGTTGTCATCCTGCATCTGCAGG + Exonic
1171459758 20:25291924-25291946 CCGTGGCATCTGGCAGCTGCTGG + Intronic
1172035822 20:32010272-32010294 CCTTGGGACCCTGCAGCTGAAGG - Intergenic
1175585627 20:60137333-60137355 CCCTGGCACCAGGCATTTGCAGG - Intergenic
1175975339 20:62708042-62708064 CTGTGGCTCCCGGCCTCTGCAGG + Intergenic
1176232531 20:64039501-64039523 CCCTGGAACCCTCCATTTGCTGG + Intronic
1181529960 22:23511811-23511833 ACGTGGCACCCAGCAGCAGCGGG + Intergenic
1183537817 22:38413292-38413314 CCTTTGCAGCCGGCATCTGCAGG - Intergenic
1184263640 22:43334114-43334136 CCCTGGGTTCCTGCATCTGCAGG - Intronic
1184950707 22:47840702-47840724 CCGTGGCTCCCTGCCCCTGCAGG + Intergenic
956751990 3:72350906-72350928 CCGTGGCTCCCCGCATGTCCTGG + Intergenic
961501039 3:127336282-127336304 GCGTGCCACCCAGCAACTGCTGG - Intergenic
968451396 4:677663-677685 CCTGGGCACCCTGGAACTGCAGG - Intronic
969655673 4:8496675-8496697 CAGTGACCGCCTGCATCTGCAGG - Intergenic
981103671 4:140857020-140857042 CAGTGGTAGCCTGTATCTGCTGG - Intergenic
985549759 5:527024-527046 CCGTGGCACCCCACCACTGCAGG + Intergenic
986276572 5:6280283-6280305 CAGTAGCACTCAGCATCTGCAGG - Intergenic
990331968 5:54736528-54736550 CCTTGGCAGCCTGCAGCTGGTGG + Intergenic
998172568 5:139881148-139881170 CCAAGGCTCCCTGCAGCTGCAGG - Intronic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
998987963 5:147782829-147782851 CCATGGCAACCAGCAGCTGCCGG - Intronic
1001138135 5:169119704-169119726 CTGTGGCACGCTGCCTCTGTGGG + Intronic
1001528606 5:172446414-172446436 CTGTGGGTCCCTGCAGCTGCAGG - Intronic
1002289017 5:178187227-178187249 CCCTGGCACCCTGTTCCTGCTGG + Intergenic
1002363635 5:178693634-178693656 CCTGAGCACCTTGCATCTGCTGG + Intergenic
1017724192 6:157265494-157265516 CAGGGGCACTCGGCATCTGCAGG + Intergenic
1017801270 6:157898378-157898400 CCGTGGATCACTGCATTTGCAGG + Intronic
1019371520 7:664374-664396 CCCTGGCACCCTCCATCTGAAGG + Intronic
1019612741 7:1945156-1945178 CCTTGGCAGCCGGCCTCTGCTGG - Intronic
1019927528 7:4203117-4203139 GCGTGGCCTCCTGCCTCTGCGGG - Intronic
1036694495 8:10965684-10965706 CGGTAACACCCTGCAGCTGCCGG - Intronic
1037581058 8:20246340-20246362 CCGTCCCAGCCTGCCTCTGCTGG + Exonic
1045194330 8:99914865-99914887 AGATGGCAGCCTGCATCTGCAGG - Intergenic
1049057984 8:140254193-140254215 CTGAGGGACCCTGTATCTGCAGG - Intronic
1051878064 9:21811665-21811687 CCGTGGCCTCCTGCTACTGCTGG + Intronic
1053013237 9:34647265-34647287 CTGTAGAGCCCTGCATCTGCAGG + Intronic
1057268446 9:93633857-93633879 CCGTGGCACCCTGTCTCTGTGGG + Intronic
1057411409 9:94819383-94819405 CCCTGGCTCCCCGCAGCTGCTGG - Intronic
1059436883 9:114282444-114282466 CCTTGGCACCCTGCAACAGGAGG - Exonic
1060800965 9:126545681-126545703 CCCTCACACCCTGCAACTGCTGG + Intergenic
1061250410 9:129423068-129423090 ACGTGGCACCCAGCAGCAGCCGG - Intergenic
1061408956 9:130407995-130408017 CCCTGGCACCATCCAGCTGCAGG - Intronic
1061571157 9:131478154-131478176 CCGTGACACCCTGCAGCTTCCGG + Intronic
1061673284 9:132201301-132201323 GCTTGGCACCCAGCCTCTGCGGG + Intronic
1062080213 9:134619797-134619819 CTGGGGCCACCTGCATCTGCAGG + Intergenic
1062282907 9:135759914-135759936 CAGTGGCACCCTCCCTCTACTGG - Intronic
1185705674 X:2264617-2264639 ACGATGCTCCCTGCATCTGCTGG - Intronic
1185911526 X:3985312-3985334 CCATGGCACCCAGCCTCTGTAGG + Intergenic
1186466447 X:9787000-9787022 CAGTGGCGGCCTGCACCTGCGGG + Intronic
1186481766 X:9901595-9901617 CCTTGGCACCATGCAACTGAAGG + Intronic
1195495380 X:105525885-105525907 CCATGGCACCCTGCATCTGCAGG + Intronic
1196438638 X:115696878-115696900 CCGTGCCTCCCTGCCTCTTCAGG + Intergenic
1196647035 X:118128949-118128971 CCGTGGCATCCTGGTACTGCTGG - Intergenic
1197010154 X:121551154-121551176 TCTTGGCACCCTGCTGCTGCTGG - Intergenic
1199716756 X:150512269-150512291 CCTTGGGACTCTGCATATGCTGG - Exonic