ID: 1118351858

View in Genome Browser
Species Human (GRCh38)
Location 14:64977836-64977858
Sequence ATTAGGACATTGATAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118351858_1118351862 23 Left 1118351858 14:64977836-64977858 CCTGTGCCTATCAATGTCCTAAT 0: 1
1: 0
2: 0
3: 17
4: 132
Right 1118351862 14:64977882-64977904 GGAGTCTCACTCTGTCACCCAGG 0: 10947
1: 44694
2: 106698
3: 138738
4: 144268
1118351858_1118351861 2 Left 1118351858 14:64977836-64977858 CCTGTGCCTATCAATGTCCTAAT 0: 1
1: 0
2: 0
3: 17
4: 132
Right 1118351861 14:64977861-64977883 CTTTTTTTTTTTTTTTGAGACGG 0: 7194
1: 95351
2: 66312
3: 83357
4: 126880
1118351858_1118351863 27 Left 1118351858 14:64977836-64977858 CCTGTGCCTATCAATGTCCTAAT 0: 1
1: 0
2: 0
3: 17
4: 132
Right 1118351863 14:64977886-64977908 TCTCACTCTGTCACCCAGGCTGG 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118351858 Original CRISPR ATTAGGACATTGATAGGCAC AGG (reversed) Intronic
900011046 1:108844-108866 ATGAGGCCATTGATAGGAATGGG + Intergenic
900027150 1:285414-285436 ATTAGGCCATTGATAGGAATGGG + Intergenic
901335145 1:8442869-8442891 ATGAGGACATTATTGGGCACTGG + Intronic
906537636 1:46560502-46560524 ATTAGGACTTTGCCAGGCAAAGG - Intronic
907166216 1:52413842-52413864 ATTGGGTCATTGAAAGGCACAGG - Intronic
907243898 1:53095043-53095065 ATGTGGACACTGACAGGCACAGG + Intronic
915074959 1:153300266-153300288 ATTGGGACATGGATAAGCAGTGG - Intronic
917423659 1:174891207-174891229 AATAGCACTTTGAGAGGCACGGG + Intronic
917837312 1:178951729-178951751 ATTTGGACATTAATTGGAACAGG - Intergenic
920796968 1:209148208-209148230 ATTAGGGCAATGCTTGGCACTGG - Intergenic
921674974 1:217966639-217966661 ATCATGAAATTGATAGGGACAGG - Intergenic
924340676 1:243027602-243027624 ATGAGGTCATTGATAGGAATGGG + Intergenic
1065015144 10:21455921-21455943 ATTAAAACATTCATATGCACAGG + Intergenic
1066317051 10:34258530-34258552 ATCAGGTGACTGATAGGCACAGG + Intronic
1066684429 10:37967149-37967171 ATTGGGAGTTTGATAGGGACTGG - Intronic
1066735825 10:38478003-38478025 ATGAGGTCATTGATAGGAATGGG - Intergenic
1067760399 10:49040753-49040775 ATTAGGTGATTTATAGGCTCTGG - Intronic
1069536475 10:69257382-69257404 ATTAGGATCTTCATAGCCACAGG - Exonic
1070005913 10:72423898-72423920 GTTAGGACATTGATAGAGATAGG + Intronic
1076215482 10:128689938-128689960 TTTATAACATTGATAGTCACTGG - Intergenic
1079009331 11:16815431-16815453 ATTAGGACAAATAAAGGCACTGG + Intronic
1083181448 11:60988513-60988535 GTTAGGACATGGATGGGCACAGG + Intronic
1086271842 11:85077097-85077119 ACTAGGACAATGCTTGGCACAGG + Intronic
1086762100 11:90644400-90644422 AATAGGACACTGACCGGCACTGG - Intergenic
1087111014 11:94467263-94467285 ATAAGCAGATTTATAGGCACAGG + Intronic
1089681998 11:120123799-120123821 ACCAGGACACTGATAGGCGCAGG - Intronic
1091833924 12:3570896-3570918 ATGAGGACAGTGAGAGGCAGGGG + Intronic
1093697197 12:22174553-22174575 ATTTTGAAATTTATAGGCACTGG - Intronic
1094630031 12:32164963-32164985 ATTAGGGCAGTGTCAGGCACGGG - Intronic
1096763975 12:53867920-53867942 ATTAGAAAACTGATAGGCATGGG - Intergenic
1099263285 12:80411232-80411254 ATTAGGACAATCACTGGCACTGG + Intronic
1105400564 13:20090746-20090768 ATTAGTACATTCATAGTAACTGG + Exonic
1107411516 13:40162612-40162634 ATTAGGACAGAGATGGGTACAGG + Intergenic
1107890478 13:44910059-44910081 ATCAGGACATTAATGAGCACAGG + Intergenic
1108028448 13:46203325-46203347 ATTAGGATATTGACAGGCAGTGG - Intronic
1110089978 13:71433282-71433304 ATTATTACTTTGATAGACACTGG - Intergenic
1111526014 13:89471801-89471823 TTTAGGACATAGGTAGGAACTGG - Intergenic
1117220641 14:53601686-53601708 ATTAGGAGATTGTTAGAAACTGG - Intergenic
1118351858 14:64977836-64977858 ATTAGGACATTGATAGGCACAGG - Intronic
1119884831 14:78131552-78131574 ATTAGGCCATAGAAAGCCACTGG + Intergenic
1121801116 14:96774962-96774984 ATTAGGACATGGATACACACAGG - Intergenic
1126982071 15:54255631-54255653 ATTAGGGTTTTTATAGGCACAGG + Intronic
1128446742 15:67769341-67769363 AAAAGGACAATGATAGCCACAGG - Intronic
1128531726 15:68455805-68455827 ATTTGTCCATTGATAGACACAGG - Intergenic
1129923092 15:79337276-79337298 ATTAGGACACAGACATGCACAGG - Intronic
1134845986 16:17440960-17440982 ATCAGAACATAGGTAGGCACTGG - Intronic
1137013918 16:35353462-35353484 ATTAAGTAATTGATAGGTACAGG + Intergenic
1138072901 16:54010664-54010686 TTTAGGACAATGAGAGTCACAGG + Intronic
1142434778 16:90049264-90049286 ATTAGGCCATTCAAAGGCAAGGG + Intergenic
1142453300 16:90198069-90198091 ATTAGGCCATTGATAGGAATGGG - Intergenic
1144715182 17:17429944-17429966 CTTAGGACACTGATATTCACAGG + Intergenic
1149188145 17:54026612-54026634 AAGATGACAATGATAGGCACTGG + Intergenic
1152984828 18:311982-312004 GTTTGGACAATGAGAGGCACTGG - Intergenic
1153438603 18:5092424-5092446 AGTAGGACAGTAATAGGCTCAGG - Intergenic
1155901804 18:31400007-31400029 TTTAGAAAATTGATAGGCATAGG + Intronic
1156850767 18:41723301-41723323 ATTAGCACTGTGCTAGGCACTGG - Intergenic
1156882291 18:42095050-42095072 ATCAGGGCATTGCTATGCACTGG - Intergenic
1158516889 18:58138245-58138267 ATTTGCACTTTGAAAGGCACTGG + Intronic
1161985207 19:7649522-7649544 ATTAGGACACAGACATGCACTGG - Intergenic
1162639866 19:11999860-11999882 AAGAGCACACTGATAGGCACTGG + Intergenic
926825478 2:16901679-16901701 AAGAGCACACTGATAGGCACTGG + Intergenic
927287612 2:21372674-21372696 ATAAAGACATTGAAAGGCAAAGG - Intergenic
927554515 2:24022684-24022706 ATTACAACATTCATAGCCACCGG + Intronic
929100564 2:38308201-38308223 ATTCGTATATTGATAGACACAGG - Intronic
934960349 2:98667498-98667520 ATGAGGAACTTGTTAGGCACTGG + Intronic
937322810 2:120971091-120971113 ATAAGGACATGGAAGGGCACAGG + Intronic
937383095 2:121399478-121399500 AATACGCCATTGTTAGGCACAGG + Intronic
939617641 2:144378756-144378778 ATTTGGACACGGATATGCACAGG - Intergenic
941009969 2:160288320-160288342 ATTAGGATAATAAGAGGCACAGG - Intronic
943002605 2:182347619-182347641 ATTAGGCAATTGATATGCATTGG - Intronic
946296325 2:218786523-218786545 ATTAGGAAAGAGAAAGGCACTGG - Intronic
946697195 2:222371781-222371803 ATTATAACACTGAAAGGCACTGG + Intergenic
948064653 2:235068061-235068083 CTTAGGACTGTGATGGGCACAGG - Intergenic
948619242 2:239223645-239223667 ATGAGGACACTGATGGCCACAGG - Intronic
949084742 2:242142713-242142735 ATGAGGCCATTGATAGGAATGGG - Intergenic
1171250437 20:23642139-23642161 ATTAGGAAACTGATCCGCACTGG + Intergenic
1176281319 20:64315200-64315222 ATGAGGCCATTGATAGGAATGGG - Intergenic
1177836204 21:26188748-26188770 ATTAGGACACAGATGGGCACAGG + Intergenic
1181912841 22:26254127-26254149 ATTAGAACATTGGTAAGCTCAGG + Intronic
1183266014 22:36825962-36825984 ATTAGGACACAGACAAGCACGGG + Intergenic
951911339 3:27753731-27753753 ATTATGACATTGAGAGGCTGAGG + Intergenic
953473229 3:43184318-43184340 ATTAGGGCAATGAAAGGCTCTGG + Intergenic
955666612 3:61355902-61355924 GTTTGGCCATTGAAAGGCACTGG - Intergenic
955979395 3:64509544-64509566 ATTAGGACATGGATATCCTCGGG - Intergenic
956108904 3:65851397-65851419 ATTTGGATTTTGATGGGCACTGG + Intronic
956224395 3:66939720-66939742 GTTAGTATATTGATAGCCACTGG + Intergenic
957031443 3:75246752-75246774 GTTATGACTTTGATGGGCACAGG - Intergenic
957823165 3:85405319-85405341 ATTAGCACATTGTTAGAAACAGG - Intronic
957837134 3:85609515-85609537 ACTAGCACAGTGATAGGTACAGG + Intronic
959766165 3:110031799-110031821 TTTAGGACAATGATAGTGACTGG - Intergenic
960119385 3:113931676-113931698 ATTAGCACTTTGAGAGGCCCAGG + Intronic
962893827 3:139696572-139696594 TTAAGGACAATGATAGGCACAGG + Intergenic
963858372 3:150280351-150280373 ATTTTCACATTGATAGGGACAGG + Intergenic
970548050 4:17149492-17149514 AATTGGACATTGATGGACACTGG + Intergenic
970574278 4:17412244-17412266 CTTAGGATTTTTATAGGCACAGG + Intergenic
971584810 4:28392079-28392101 ATTAGGCCATTGAAAACCACTGG + Intronic
972370084 4:38415028-38415050 TTTAGTACATTGATATGCTCAGG - Intergenic
975528146 4:75373684-75373706 ATTTGGCCAGTGAGAGGCACTGG - Intergenic
976399579 4:84592638-84592660 AATATGAAATTGAAAGGCACAGG + Intronic
977090172 4:92663276-92663298 ATTAGGGCATTAATAAACACTGG + Intronic
978189253 4:105894509-105894531 ATGAGGACATTGAGAGGTACGGG + Intronic
979262174 4:118660946-118660968 ATGAGGTCATTGATAGGAATGGG - Intergenic
981906586 4:149928101-149928123 ATTAGGACATTTATACATACTGG - Intergenic
983149667 4:164262405-164262427 ATGAGGTCATTGATAGGAATGGG + Intronic
983290878 4:165803027-165803049 ATTATTACATGGATAGGCTCAGG - Intergenic
984436507 4:179717225-179717247 ATTAGGAGATTGATATTCCCTGG - Intergenic
987811707 5:22845277-22845299 ATTAGTACATTTATAGGCCAAGG + Intronic
990177372 5:53122833-53122855 ATTAGTTCATTCAGAGGCACTGG + Intergenic
993001029 5:82380535-82380557 ATGAGGAAATTGTTAGGAACTGG - Intronic
993680174 5:90867953-90867975 ATTAGGAAATTGAGAAGCAGAGG + Intronic
994193106 5:96890458-96890480 AATAGGCCATTGACAGGTACTGG + Intronic
995809492 5:116088685-116088707 AGAAGGACATTTATAGGCAAGGG - Intronic
997576222 5:134979684-134979706 AGTAGGACATTGAGAAGCTCCGG + Intronic
999797879 5:155005012-155005034 ATGAGGACAGTGATAGTGACAGG - Intergenic
999851170 5:155541333-155541355 ATGACGAAATTGATAGGAACAGG + Intergenic
1001000399 5:168000701-168000723 ATTTGGAAAGAGATAGGCACAGG + Intronic
1001410364 5:171507125-171507147 ATTAGCACCATGACAGGCACTGG - Intergenic
1003810550 6:9774876-9774898 ATTAGGACATTACTAGGTGCTGG - Intronic
1005595120 6:27371625-27371647 ATAAGGACTTTTATAGGCACTGG + Intergenic
1007309170 6:40931771-40931793 ATTAGGACACAGGTAGGCACAGG + Intergenic
1007993502 6:46282054-46282076 TTTAGGACTTTGCTAGGCCCTGG - Intronic
1010693374 6:78938236-78938258 ATTTGGACATTATTAGACACTGG - Exonic
1011457722 6:87570120-87570142 ATTAAGCCTTTGATAGGGACGGG - Intronic
1013028642 6:106307490-106307512 ATTAGTACATGGATAAGCACAGG + Intronic
1013721297 6:113031703-113031725 ATGAAGACAGTGATAGGCACTGG + Intergenic
1014892169 6:126855933-126855955 ATTAGGACAGTGATTGCCACGGG - Intergenic
1020369703 7:7418360-7418382 ATTTGGACATTGATATCCACTGG - Intronic
1024265099 7:47600358-47600380 AAGAGCACATTGACAGGCACCGG + Intergenic
1026662064 7:72310976-72310998 AATATGACATTGAAAGGCACGGG + Intronic
1026836516 7:73643262-73643284 ATTAGGACATTGGGAGGCCGAGG + Intergenic
1029014267 7:97298396-97298418 ATTAGCACAGTGATAGGTGCTGG + Intergenic
1031441812 7:121803845-121803867 ATTAGGACATGGCTAGGGCCTGG + Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1037194429 8:16170600-16170622 ATTAGAAAATTGATAGACTCAGG - Intronic
1039495561 8:37977471-37977493 ATTAGGATGTGGAAAGGCACAGG + Intergenic
1041503507 8:58566997-58567019 ATTAGGAAACTGATAAGCTCTGG - Intronic
1041956007 8:63558742-63558764 CTTCGGACACTGATAAGCACAGG + Intergenic
1045429052 8:102096310-102096332 ATTAGGACACAGATACACACAGG - Intronic
1047210582 8:122836891-122836913 ATTAGGGCATTCTAAGGCACAGG + Intronic
1052178365 9:25493590-25493612 GTTAGGACTTTGATGGGCAGTGG + Intergenic
1052681253 9:31696018-31696040 ATTTATTCATTGATAGGCACAGG - Intergenic
1186425177 X:9458756-9458778 ATTAGGACACAGACACGCACAGG - Intergenic
1187280057 X:17851558-17851580 AATAGGAAATTCATCGGCACAGG + Intronic
1187981097 X:24758491-24758513 TTTTGGACATTGAAAGGTACAGG + Intronic
1195975178 X:110519203-110519225 ATTAGGATGTTCATAGGCAAAGG + Intergenic
1196251021 X:113460019-113460041 ATGAGGACATTGATATGAACTGG - Intergenic
1196976835 X:121167579-121167601 ATTAGGACATTGGCTAGCACTGG - Intergenic
1197418875 X:126211826-126211848 ATTGAGACATTGATAGGAATTGG - Intergenic
1202384250 Y:24309434-24309456 ATGAGGTCATTGATAGGAATGGG - Intergenic
1202486533 Y:25360690-25360712 ATGAGGTCATTGATAGGAATGGG + Intergenic