ID: 1118353002

View in Genome Browser
Species Human (GRCh38)
Location 14:64987341-64987363
Sequence TTCTCGTTCTTTAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118353002_1118353012 24 Left 1118353002 14:64987341-64987363 CCCTCTGCCCTAAAGAACGAGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1118353012 14:64987388-64987410 CAGAGGCAGCCCGTGCGGGTCGG 0: 1
1: 0
2: 1
3: 26
4: 160
1118353002_1118353006 -3 Left 1118353002 14:64987341-64987363 CCCTCTGCCCTAAAGAACGAGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1118353006 14:64987361-64987383 GAAGAATCGTGTTCTATGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 74
1118353002_1118353010 19 Left 1118353002 14:64987341-64987363 CCCTCTGCCCTAAAGAACGAGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1118353010 14:64987383-64987405 GAGGACAGAGGCAGCCCGTGCGG 0: 1
1: 0
2: 2
3: 40
4: 358
1118353002_1118353008 7 Left 1118353002 14:64987341-64987363 CCCTCTGCCCTAAAGAACGAGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1118353008 14:64987371-64987393 GTTCTATGCCTGGAGGACAGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
1118353002_1118353011 20 Left 1118353002 14:64987341-64987363 CCCTCTGCCCTAAAGAACGAGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1118353011 14:64987384-64987406 AGGACAGAGGCAGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 23
4: 288
1118353002_1118353007 0 Left 1118353002 14:64987341-64987363 CCCTCTGCCCTAAAGAACGAGAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1118353007 14:64987364-64987386 GAATCGTGTTCTATGCCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118353002 Original CRISPR TTCTCGTTCTTTAGGGCAGA GGG (reversed) Intronic
903089585 1:20899834-20899856 TTCACTTTTTTTAGGTCAGAGGG + Exonic
904226866 1:29028523-29028545 TTCTCGTTTTATAGAGGAGATGG + Intronic
914844395 1:151273791-151273813 TTCTTGTTCTTTAGGGGCGAGGG + Intergenic
916573890 1:166050499-166050521 TTTTCCATCTTTAGGGGAGATGG + Intergenic
917200207 1:172506836-172506858 ATCTGGTTATTTAGGTCAGAAGG + Intergenic
918090687 1:181291462-181291484 TTCTTGGTCTCTAGGACAGATGG + Intergenic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
1064294887 10:14069984-14070006 TACTTGTTCTTTAAGGCATATGG - Intronic
1064314422 10:14241815-14241837 TTCCCATCCTGTAGGGCAGATGG - Intronic
1065313447 10:24438645-24438667 TCCTGGTTATTTAGGGCAAAGGG + Intronic
1066405252 10:35112268-35112290 TTCTAGTTGTTTTAGGCAGAAGG - Intergenic
1067302854 10:45028971-45028993 TTCTCTTTTTTTGGGGGAGAAGG + Intergenic
1069726859 10:70585729-70585751 TTCTCCTTCTGCAGGACAGAGGG - Intergenic
1072628706 10:97131165-97131187 GTGTGGCTCTTTAGGGCAGAAGG - Intronic
1074748673 10:116561772-116561794 TTCTGTTTCTTTAGGGAAAAGGG + Intronic
1080355525 11:31440305-31440327 TTCTAGTTGTTTATGGCAGGAGG + Intronic
1080780182 11:35421997-35422019 TTCTCTTTCTTTGTGCCAGAGGG + Intergenic
1081302076 11:41464843-41464865 TTTTCTTTCTTTAGGGGGGAAGG + Intergenic
1085466684 11:76728745-76728767 TTTTTGTTCTTTAGGAGAGAGGG + Intergenic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1085704424 11:78773456-78773478 TTCTCTCTATTTTGGGCAGAGGG + Intronic
1086782784 11:90928926-90928948 CTTTCGTTCTTTTGGGCAAAAGG + Intergenic
1093476329 12:19558805-19558827 TTCTCATTGTTTTGGGCGGAGGG - Intronic
1099521174 12:83664904-83664926 TTGTCTTTCTTTAAGGCAGATGG - Intergenic
1100441844 12:94624540-94624562 TTTTCGTTTTTTAGTGGAGACGG - Intronic
1101047138 12:100820161-100820183 TTCTAGATGTTTAGAGCAGAAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1103963889 12:124626019-124626041 TCCCCGTTCTGGAGGGCAGAAGG - Intergenic
1105825629 13:24120062-24120084 TTCTCTGTCTTTGGGGCAGATGG + Intronic
1106964260 13:35040103-35040125 TTATCGTTCTTTAGACCAAAAGG + Intronic
1110856433 13:80301873-80301895 TTCTCTTTATTTAGGGTGGAAGG - Intergenic
1111341479 13:86891782-86891804 TTCCTGTTCTTACGGGCAGAAGG + Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1111761033 13:92464490-92464512 TTCTCTTTCTTTAGGGTTAATGG - Intronic
1114639208 14:24207731-24207753 TTCTTTCTCTTTAGGCCAGAAGG + Intronic
1115730410 14:36262528-36262550 TTCTCTGTCTTTAGGGGAGTTGG + Intergenic
1116694814 14:48159595-48159617 TTCTTATTCTTTAGGCCACAAGG - Intergenic
1116699435 14:48220930-48220952 TTCTTGTTATGTAGGGCAGATGG - Intergenic
1118348095 14:64954395-64954417 TTCTCGTTCTTCTTGGAAGAAGG - Intronic
1118353002 14:64987341-64987363 TTCTCGTTCTTTAGGGCAGAGGG - Intronic
1119611166 14:76063645-76063667 TTCTAGTTGTTTATGGCAAAAGG + Intronic
1120928419 14:89821553-89821575 TTTTCATTCTTTATGGCAGAAGG - Intronic
1122147037 14:99697628-99697650 TTCTGGTTGTTTATGGCACAAGG + Intronic
1122962477 14:105102226-105102248 TTATCGTTGTTTATGGCAGGAGG - Intergenic
1123803320 15:23844926-23844948 TTCTAGTTGTTTATGGCAGGAGG - Intergenic
1124943106 15:34236512-34236534 TTTTCGTACTTTAGTACAGATGG + Intronic
1126822874 15:52522142-52522164 TGCTTGCTCATTAGGGCAGAAGG - Intronic
1128038406 15:64547533-64547555 TTATCATTCTTTAGAGCACAGGG - Intronic
1128157972 15:65403789-65403811 TTCTATTTCTTTAGCCCAGAGGG - Intronic
1128953567 15:71914338-71914360 TTCTGGTTGTTTATAGCAGAAGG + Intronic
1129331482 15:74830115-74830137 GTCTCGTTCTGAAGGGAAGAGGG - Exonic
1130894476 15:88159596-88159618 GTCTACTTCTTTAGGGCAGAGGG - Intronic
1132530251 16:444302-444324 TTCTCCTTGTAAAGGGCAGAGGG + Intronic
1133799090 16:9070454-9070476 AGCTGGCTCTTTAGGGCAGAGGG - Intergenic
1136472334 16:30489415-30489437 TTCTGGTTGTTGAGGTCAGATGG + Intronic
1140114832 16:72032876-72032898 TTTTCCTTCTGTAGGGCATATGG - Intergenic
1143414423 17:6735660-6735682 TTCCCGTTCATTTGGGGAGAGGG + Intergenic
1148968993 17:51462880-51462902 TTATCTTGCCTTAGGGCAGAGGG + Intergenic
1149311569 17:55399280-55399302 TTACAGTTCTTTATGGCAGAAGG + Intronic
1151239389 17:72745956-72745978 TACTCTGTCTTTAGGGGAGATGG - Intronic
1151830774 17:76548791-76548813 TTCTGGTTGTTTGTGGCAGAAGG - Intronic
1153144888 18:2020023-2020045 TTCTTTTTCTTTAGGGGAAACGG + Intergenic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1156763522 18:40622937-40622959 TTCTTTTTCTTTAAGGCATATGG + Intergenic
1156918459 18:42489229-42489251 TTCTCGTCCATCAGGGCAAATGG + Intergenic
1162172980 19:8805795-8805817 TCCTCATTCTTTAGTGCTGAGGG + Intergenic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1166975951 19:46605129-46605151 TTTTGTTTCTTTTGGGCAGAAGG - Intronic
930882453 2:56287511-56287533 TTCTAGTTGTTTATGGCAGGAGG + Intronic
933615407 2:84478138-84478160 TTCACCTTATTTAGGGAAGATGG + Intergenic
935081050 2:99794897-99794919 TTCTAGTTGTTTATGGCAGGAGG + Intronic
935446320 2:103160333-103160355 TTCTCCATGTTTAGGGCAAAAGG - Intergenic
935607112 2:104982346-104982368 TTCTCTGTCTTTAGGCCTGATGG - Intergenic
937379119 2:121360518-121360540 TTGCCATTTTTTAGGGCAGAAGG - Intronic
943745227 2:191455152-191455174 TTCTTGCTCCTTAGGGCAAAAGG + Intergenic
943962393 2:194282361-194282383 TTCTCATTCTTTGGGGAAGATGG + Intergenic
945861033 2:215122700-215122722 TTTCCCTTCTTTAGGTCAGAAGG + Intronic
1173662480 20:44744299-44744321 TTCTAGTTCTGTAGGGTGGAGGG + Intergenic
1174927211 20:54773556-54773578 TTATCATTATTTGGGGCAGAGGG - Intergenic
1175334279 20:58185018-58185040 TTCCCGTTCTAGAGGCCAGAAGG - Intergenic
1175632149 20:60550296-60550318 GTCTCTTCCTTTAGGGCAGTGGG + Intergenic
1177958986 21:27637993-27638015 TTCTCCTACCTTAGGGTAGAAGG + Intergenic
1179204369 21:39260584-39260606 TTGTAGTTGTTTATGGCAGAAGG - Intronic
1183736689 22:39648435-39648457 CTCTCGTTTTCCAGGGCAGAGGG - Intronic
949780481 3:7681214-7681236 TTCCTGTTGTTTAAGGCAGAAGG + Intronic
950805717 3:15601587-15601609 TTCCCGTTGTTTAAGGCAGTTGG - Exonic
951371145 3:21850228-21850250 TCCTAGTTCTTTGTGGCAGAAGG - Intronic
951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG + Intergenic
953529469 3:43727116-43727138 TTCTGGTTCTTGAAGCCAGAAGG + Intronic
953590242 3:44244965-44244987 TTCTTGTTCATTACAGCAGAAGG - Exonic
956195310 3:66648500-66648522 TTCTACTACTTTAGGGCAGATGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957321868 3:78641926-78641948 TGCTAGTTATTTAAGGCAGAAGG + Intronic
958755441 3:98245631-98245653 TTCTCGTTCATACGGGGAGAGGG - Intergenic
961971333 3:130971739-130971761 TGCTGCTTCTTTAGGCCAGACGG + Intronic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
964849890 3:161084193-161084215 GTCACGTTCTTTAAGACAGATGG - Exonic
967677510 3:192317347-192317369 GTCTCGCTCTTTAGGACAGTGGG - Intronic
977534082 4:98236683-98236705 TCCTCCTCTTTTAGGGCAGATGG + Intergenic
983089093 4:163483168-163483190 TTCTCTTGCTTTGGGGCTGAGGG + Intergenic
984451898 4:179913133-179913155 TTCTACTGCTTTATGGCAGAAGG + Intergenic
987804249 5:22742345-22742367 TTCTTGTTCCTTAAGACAGAGGG - Intronic
988867022 5:35346411-35346433 TTCTCCTCCTTTGGGACAGATGG - Intergenic
990801501 5:59609247-59609269 TTCTCCCTCTTTAAGGCACATGG + Intronic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
991499494 5:67262948-67262970 TTCTAGTTCTCTGGGGCTGAAGG + Intergenic
992623565 5:78616861-78616883 TTCTCCTTAATTAGGGCAGGTGG - Intronic
992669398 5:79043735-79043757 TTCAAGTTCTTTAAGGGAGATGG - Intronic
993713966 5:91256166-91256188 TTCTCTTTCTTTAGGGGGGCAGG + Intergenic
993975258 5:94472298-94472320 TTCTCTTCCTTAATGGCAGAAGG + Intronic
995236719 5:109837371-109837393 TTTTTGTTTTTAAGGGCAGAGGG - Intronic
997971083 5:138402649-138402671 TTCTCATTGTTTATGGCAGGAGG - Intronic
999345629 5:150816746-150816768 TGCTGGTTTTTTAGGGCACAAGG - Intergenic
1000829323 5:166083733-166083755 TTCTCTCTCTTTTAGGCAGAGGG + Intergenic
1001971828 5:175962265-175962287 TTCTGGTTCTCAAGGGCACAGGG - Intronic
1002245615 5:177881516-177881538 TTCTGGTTCTCAAGGGCACAGGG + Intergenic
1002296521 5:178234348-178234370 TTTTCCTGCTTTAAGGCAGAGGG + Intergenic
1003453608 6:6260781-6260803 TTCTCCTTCCTTAATGCAGAGGG - Intronic
1003702402 6:8482168-8482190 TTCTAGTTATTTAAGGCAGAAGG + Intergenic
1005696752 6:28358937-28358959 TTCCAGTTCTATAGGTCAGAAGG + Intronic
1006258864 6:32852494-32852516 TTCTCTTTCTCCAGGGGAGATGG - Exonic
1007807034 6:44458129-44458151 TTGTTGTTCTAAAGGGCAGATGG + Intergenic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1009512228 6:64567840-64567862 TTCTAGTTGTTTAGAGCAGAAGG - Intronic
1009993394 6:70871764-70871786 TTCTGTTTTTTTATGGCAGAAGG + Intronic
1010540033 6:77082025-77082047 TTTTTTCTCTTTAGGGCAGAAGG + Intergenic
1011004734 6:82631498-82631520 TTCTCTTTCTTTAGTGAATAGGG + Intergenic
1013160795 6:107542842-107542864 TTTTCTTTCTGTAGGGCAGGTGG + Intronic
1016309653 6:142719965-142719987 TTCTAGTTGTTTAAGGCAGGGGG + Intergenic
1016644079 6:146383872-146383894 TTCTAGTTGCTTATGGCAGAAGG - Intronic
1017388819 6:153915685-153915707 TTCTCGTGCTTTTGGGCAATGGG - Intergenic
1018231672 6:161681844-161681866 TTCTCGTTCTTCATGCCAAAGGG + Intronic
1019264563 7:106567-106589 TTGTGGTTCTTTAGGGCTGGGGG + Intergenic
1025717038 7:63968448-63968470 TTCTCTTACTTTAATGCAGAAGG + Intergenic
1025797489 7:64753052-64753074 TTGTCATGCTTTAGGGCACAGGG + Intergenic
1028160951 7:87484032-87484054 AACTCATTCTTTAGGGCAGTGGG - Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029044060 7:97608715-97608737 TTATTGTTCCTTTGGGCAGATGG - Intergenic
1031668438 7:124514500-124514522 TTCTCGTTCTCTAAGGCTGTTGG + Intergenic
1037771196 8:21801123-21801145 TTCTCCTTCCTCAGGGCTGATGG - Intronic
1038261962 8:26003409-26003431 ATCTCCTTCTTTTGGGGAGAGGG - Intronic
1040387592 8:46924075-46924097 CTCTCCTCCTTTAGGGAAGATGG - Intergenic
1041963180 8:63643605-63643627 TTCTCAGTCTTTATGGCATAAGG + Intergenic
1046077209 8:109327430-109327452 TTTTCTTTCTTCAGAGCAGAGGG - Intronic
1048977592 8:139681664-139681686 CTCTTGTTCCTTATGGCAGAGGG - Intronic
1050915440 9:11124765-11124787 TTATAGTTCTCTAGGTCAGAAGG + Intergenic
1053110192 9:35453235-35453257 TGCTGGTTCTTTAGGGCCCAAGG - Intergenic
1053186592 9:36021723-36021745 TTCCCTTCCCTTAGGGCAGATGG - Intergenic
1057325294 9:94057926-94057948 TTCTAGTTGTTTTAGGCAGAAGG - Intronic
1059016515 9:110522590-110522612 CTCTCTTTCTTTAGGACAGGCGG - Intronic
1060429539 9:123538189-123538211 TTCTGATTCTCAAGGGCAGAAGG - Intronic
1061819307 9:133217177-133217199 CTCTCATTCTTTGGGGCACAAGG + Intergenic
1062241380 9:135541011-135541033 CTCTCATTCTTTGGGGCACAAGG - Intergenic
1187613961 X:20972913-20972935 TTCTGCTTCTTTGGGGCAGGAGG + Intergenic
1194340172 X:92697430-92697452 TACTTGTTCTTCAGGTCAGAAGG + Intergenic
1194955429 X:100173741-100173763 TTCTCTTTCTTTGGAGAAGATGG - Intergenic
1196003046 X:110806943-110806965 TTCTCATTCCTAAGGGCAGTGGG + Intergenic
1196628778 X:117910728-117910750 ATGTCTTTCTTAAGGGCAGAGGG + Intronic
1197016020 X:121627007-121627029 TTCTCTTCCTTTAGGGAAGTAGG - Intergenic
1197493324 X:127146763-127146785 TTCTTGTTGTTTTGGGCAGATGG - Intergenic
1200648544 Y:5814193-5814215 TACTTGTTCTTCAGGTCAGAAGG + Intergenic