ID: 1118354470

View in Genome Browser
Species Human (GRCh38)
Location 14:65001437-65001459
Sequence GAGTATACTCACACCAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 2, 2: 20, 3: 85, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118354470_1118354475 12 Left 1118354470 14:65001437-65001459 CCCAGGTTGGTGTGAGTATACTC 0: 1
1: 2
2: 20
3: 85
4: 243
Right 1118354475 14:65001472-65001494 CATGATGAAATCACCTAAGAAGG 0: 1
1: 1
2: 2
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118354470 Original CRISPR GAGTATACTCACACCAACCT GGG (reversed) Intronic
901582880 1:10260096-10260118 GAGTGTACTTACACAAACCCTGG + Intronic
903982096 1:27196440-27196462 GAGTGTACTTACACAAACCTAGG - Intergenic
905701117 1:40015336-40015358 GAGTATACTGATTCAAACCTTGG + Intergenic
907322081 1:53609786-53609808 GAATGTACTTACACAAACCTAGG + Intronic
908942201 1:69448744-69448766 GAGTATACATACACAAACCTAGG - Intergenic
909004511 1:70259055-70259077 GGGTGTACTTACACAAACCTAGG - Intergenic
909469619 1:76012366-76012388 GAGTATACTCAGACAACCCCAGG + Intergenic
910143049 1:84047820-84047842 GAATATACTTACACAAACCTAGG + Intergenic
911245742 1:95514936-95514958 GAGTGTATTTACACAAACCTAGG + Intergenic
911426167 1:97715582-97715604 GAGTAAACTAACACCACCCCAGG - Intronic
911545220 1:99208110-99208132 GAGTATACCAACACAAACCTAGG + Intergenic
917169873 1:172159864-172159886 GAGTGTATTTACACAAACCTAGG + Intronic
918540774 1:185630141-185630163 GAGTATACTTACACAAATGTAGG + Intergenic
918691664 1:187488149-187488171 GAGGACACTCACACCATCCCTGG - Intergenic
919176267 1:194022291-194022313 GAGTGTACTTTCACAAACCTAGG - Intergenic
919378359 1:196821854-196821876 GAGTGGACTTACACAAACCTAGG + Intronic
919388053 1:196945891-196945913 GAGTGGACTTACACAAACCTAGG + Intronic
920037231 1:203074231-203074253 GAATGTACTTACACAAACCTAGG + Intronic
920328721 1:205188356-205188378 GAGTGTACTTACACAAACTTAGG + Intronic
920967076 1:210710043-210710065 GAGTATACTTAAACCAAGATGGG + Intronic
921172800 1:212564200-212564222 GAGTGTACTTACACAAACCTAGG - Intergenic
921211076 1:212898754-212898776 AAGTGTACTTACACAAACCTAGG + Exonic
921788820 1:219265700-219265722 GAGTGTACTTTCACAAACCTAGG + Intergenic
922375160 1:224956544-224956566 GAGTGCACTTACACAAACCTAGG - Intronic
922671954 1:227516518-227516540 GAATGTACTTACACAAACCTAGG + Intergenic
1062891116 10:1060960-1060982 GAGTACACTTACACAAAGCTAGG - Intronic
1065135860 10:22669348-22669370 GAGTGTACTCACATGACCCTAGG - Intronic
1065781356 10:29171158-29171180 GAGTGTACTTACACAAACCTAGG + Intergenic
1065783069 10:29188821-29188843 GAGTGTACTTACACAAACCAAGG - Intergenic
1065809240 10:29426210-29426232 GAGTGTACTTACACAAACCAAGG - Intergenic
1066169946 10:32831046-32831068 GAGTATACTTACACAAACCTAGG + Intronic
1066520651 10:36214441-36214463 GAGTATACTCACATAAAGGTGGG - Intergenic
1067101261 10:43336351-43336373 GAGTGTTCTCACAGCAGCCTGGG + Intergenic
1067122194 10:43483133-43483155 GGGTGTTCTCACCCCAACCTGGG - Exonic
1068065397 10:52124252-52124274 GAGTCTACTCACACAAACCTAGG + Intronic
1068306732 10:55220503-55220525 GAGTATACTTACACAAGCCCAGG + Intronic
1068561152 10:58515339-58515361 GAGTGTAGTTACACAAACCTAGG + Intronic
1069497526 10:68919100-68919122 GAGTGTACTTACACAAACCTAGG - Intronic
1070084723 10:73225970-73225992 GAGTGTATTTACACAAACCTAGG - Intronic
1071200337 10:83214945-83214967 GAGTGTACTTAAACAAACCTAGG + Intergenic
1073162353 10:101409520-101409542 TAGTGTACTTACACAAACCTAGG + Intronic
1074656087 10:115588699-115588721 GAATATACCCACACCAACACGGG - Intronic
1074913453 10:117933528-117933550 GAGTGTCCTTACACAAACCTAGG - Intergenic
1074993750 10:118736990-118737012 GGGTATACTTACACAAACCTAGG - Intronic
1077861472 11:6184920-6184942 GAGTGTACTTACACCAACCTAGG - Intergenic
1080003439 11:27378052-27378074 GAGTATGCTTACACAAACCTCGG - Intronic
1080511559 11:32978954-32978976 TAGTGTACTTACACAAACCTAGG + Exonic
1081472277 11:43386327-43386349 GAGTGTACTTACACAAACCTAGG + Intronic
1084065227 11:66700330-66700352 GAGAATATCCAGACCAACCTGGG - Intronic
1084135468 11:67176602-67176624 GAGTGTACTTACACAAACCTGGG + Intronic
1084293390 11:68192101-68192123 GAGTGTACTTACACAAACCTAGG - Intronic
1085438795 11:76538071-76538093 GAGCAAATTCACACCATCCTTGG + Intronic
1086293805 11:85341765-85341787 GAGTGTACTTACACAAGCCTAGG + Intronic
1086327200 11:85714333-85714355 GAATACAAACACACCAACCTTGG + Intronic
1086961467 11:92983116-92983138 GAGAATCCTCACAACAACCTGGG - Intronic
1087467625 11:98529241-98529263 GAGTGTACTTACACAAAACTAGG + Intergenic
1087550426 11:99640756-99640778 GAGTATACTTACACAAACCTAGG - Intronic
1089050588 11:115542043-115542065 GAGTCAACTTACACAAACCTGGG - Intergenic
1089577341 11:119454653-119454675 GAGTGTACTCACTCAAACCCAGG - Intergenic
1089803593 11:121061511-121061533 GAGTATACTTACACAAACCTAGG + Intronic
1089948516 11:122503107-122503129 GAGTATACTTACACAAACCTAGG - Intergenic
1090480762 11:127066315-127066337 GTGTATATTCACACAAATCTGGG - Intergenic
1091084012 11:132703153-132703175 GAGTATACTCACACAAGCCTAGG + Intronic
1091369651 11:135047475-135047497 GAGTACACTCAGAGCCACCTGGG + Intergenic
1092665273 12:10790441-10790463 TAGTGTACTCACAAAAACCTAGG + Intergenic
1093849676 12:24020309-24020331 GAGGTTACTAACACAAACCTGGG + Intergenic
1093956432 12:25224788-25224810 GAATATACTTACACAAACCTTGG - Intronic
1094287594 12:28812835-28812857 TCCTACACTCACACCAACCTTGG - Intergenic
1094812628 12:34153877-34153899 GAATGTACTCACACAAACCTAGG - Intergenic
1096452882 12:51759255-51759277 GAGTGTACTTACACAAACCTAGG - Intronic
1097852201 12:64423366-64423388 GTTTATATTGACACCAACCTTGG + Intronic
1098159453 12:67635305-67635327 GAGTGCACTTACACAAACCTGGG + Intergenic
1098809321 12:75065705-75065727 GAGTGTACTCACATAAACCTAGG - Intronic
1102395695 12:112584070-112584092 GAGTCCCCTCCCACCAACCTAGG - Intronic
1103849584 12:123923494-123923516 AGGTAAAATCACACCAACCTGGG - Intronic
1106417346 13:29557391-29557413 GAGTGTACTGACAGAAACCTAGG + Intronic
1106711680 13:32342566-32342588 GAGTATACTTACACAAACCTAGG + Intronic
1107087910 13:36445934-36445956 GAGTGTACTCACACAAACCTCGG - Intergenic
1108234291 13:48386275-48386297 GAGTGTGCTTACACAAACCTAGG + Intronic
1108361854 13:49675143-49675165 GAGTGTATTCACACAAACCTAGG + Intronic
1108662127 13:52596902-52596924 GAGCATACACACACGACCCTAGG + Intergenic
1109052925 13:57507607-57507629 GAGTACACTCACACAAACTTAGG - Intergenic
1109556680 13:63985302-63985324 GAGTGTACTTACACCAACATAGG + Intergenic
1110104165 13:71649245-71649267 GAGCGTACTTACACAAACCTAGG - Intronic
1110802875 13:79720657-79720679 GAGTGTACTTACGCAAACCTAGG + Intergenic
1110817098 13:79873963-79873985 CAACACACTCACACCAACCTAGG - Intergenic
1111061439 13:83024172-83024194 GAGTGTACTTACACAAACGTAGG - Intergenic
1111133685 13:84010398-84010420 GAGTGTACTTCCACAAACCTAGG - Intergenic
1111782551 13:92746895-92746917 GAGTGTACTTACACAAACCTAGG + Intronic
1113236821 13:108285404-108285426 GAGCATACTTACACAAACCTAGG + Intronic
1114215088 14:20651580-20651602 GAGTATACTTACACAAACTAAGG - Intergenic
1115836911 14:37416398-37416420 GAGTGTATTTACACAAACCTAGG + Intronic
1115857149 14:37642722-37642744 TAGTGTACTTACACAAACCTAGG + Intronic
1116349786 14:43846518-43846540 GAGTATACTTACACTCACCTAGG - Intergenic
1116449382 14:45047961-45047983 CAGGAGAATCACACCAACCTGGG + Intronic
1116499200 14:45599797-45599819 GAGTATACTCACACAAACCTAGG - Intergenic
1116753375 14:48915197-48915219 GAGTGTACTTACATGAACCTAGG + Intergenic
1117138224 14:52759453-52759475 GAGTCTAATAACACCTACCTTGG - Intronic
1118354470 14:65001437-65001459 GAGTATACTCACACCAACCTGGG - Intronic
1118529788 14:66690821-66690843 GAGTGTACTTACACAAACCGAGG - Intronic
1120267745 14:82272930-82272952 GGGTATACTTACACAAACTTAGG - Intergenic
1120560293 14:85983612-85983634 GAGTATACTTACCCAAAGCTAGG - Intergenic
1120783399 14:88507366-88507388 GAGTATACTTACACAAACCTAGG + Intronic
1122709544 14:103645572-103645594 GAGTACATTTACACAAACCTAGG + Intronic
1123966259 15:25462119-25462141 GAGTGTGCTTACACAAACCTAGG - Intergenic
1124447925 15:29755240-29755262 GAGTGTACTTACACAAACCTAGG - Intronic
1124716033 15:32062877-32062899 GAGTCTACTTACACAGACCTAGG + Intronic
1125681983 15:41536675-41536697 GAGTATATGCACACCTTCCTAGG + Intronic
1127010188 15:54617069-54617091 AAGTGTACTTACACAAACCTAGG - Intronic
1127936988 15:63650454-63650476 CATTGTACTCACTCCAACCTGGG - Intronic
1128789777 15:70424500-70424522 GAGTGTACTTACTCTAACCTAGG - Intergenic
1129785831 15:78309504-78309526 GAGTAGACTCACCCCACACTGGG + Intergenic
1130358385 15:83156636-83156658 GAGTATACTTACACAAATGTAGG - Intronic
1131736855 15:95341929-95341951 GAGTGCACTTACACAAACCTAGG + Intergenic
1133719624 16:8482926-8482948 GAGTGTACTCACAGCTACTTGGG - Intergenic
1133923407 16:10175161-10175183 GAGTGCACTTACACAAACCTAGG - Intronic
1134029416 16:10979760-10979782 GTGCATACACACAGCAACCTTGG + Intronic
1136017953 16:27417597-27417619 GAGTGCACTTACACAAACCTAGG + Intronic
1136535869 16:30899091-30899113 GAGTGTATTTACACAAACCTAGG - Intronic
1137278582 16:46954775-46954797 GAGTGTACTTCCACAAACCTAGG - Intergenic
1137345864 16:47658707-47658729 GAGTGTACTTACACAAACGTAGG - Intronic
1137382639 16:48013197-48013219 TAGTATACTCAAAGAAACCTGGG - Intergenic
1139235092 16:65329470-65329492 GTGTAAACTGTCACCAACCTTGG - Intergenic
1139790870 16:69433842-69433864 GAGTATATTTACACAAACCTAGG + Intronic
1143206233 17:5141195-5141217 GAGTGTACCTACACAAACCTAGG - Intronic
1144581804 17:16463449-16463471 GACTGTCCTCACACCATCCTGGG + Intronic
1145353855 17:22118576-22118598 GATGATTCTCACACAAACCTAGG - Intergenic
1145869451 17:28261390-28261412 GCGTATACTTACACAAACCCAGG - Intergenic
1146257362 17:31399227-31399249 GAGCTGAGTCACACCAACCTGGG + Intronic
1146340936 17:32019396-32019418 GTGTATACTTACACAAACATAGG - Intronic
1146553447 17:33802321-33802343 GAGTCTACTGACACAAACTTAGG - Intronic
1146899560 17:36574306-36574328 GAGTGTACTTACACAAACCTAGG - Intronic
1147640511 17:41995652-41995674 AAGTATACTTACACAAACCTGGG - Intronic
1148174516 17:45552018-45552040 GCGTATACTTACACAAACCTAGG + Intergenic
1148274751 17:46293429-46293451 GCGTATACTTACACAAACCTAGG - Intronic
1148296854 17:46511008-46511030 GCGTATACTTACACAAACCTAGG - Intergenic
1148361408 17:47015483-47015505 GCATATACTTACACAAACCTAGG - Intronic
1149874008 17:60212300-60212322 GAGTGTACCTACACAAACCTAGG + Intronic
1150087787 17:62289568-62289590 GAGTGTACCTACACAAACCTAGG + Intergenic
1150405735 17:64898940-64898962 GCGTATACTTACACAAACCTAGG + Intronic
1150784868 17:68154091-68154113 GCGTATACTTACACAAACTTAGG + Intergenic
1151072418 17:71230936-71230958 GAGTGCACTTACACAAACCTAGG - Intergenic
1154326110 18:13391451-13391473 GAGTATACCCACACTCACCCAGG - Intronic
1155822956 18:30401418-30401440 GAGTGTACTTACACAAACCTAGG - Intergenic
1157532903 18:48437112-48437134 GAGTGTACTTACACAAACCTAGG + Intergenic
1158889663 18:61861457-61861479 GAGTACACTTACACAAGCCTAGG - Intronic
1158941331 18:62407827-62407849 GAGTGTTCTCACACAATCCTAGG + Intergenic
1158952650 18:62509190-62509212 GAGTATACTTATACAAACCTAGG + Intergenic
1163799082 19:19354273-19354295 GATTATCCCCACCCCAACCTGGG + Intronic
1163892602 19:20030122-20030144 GATTAAAATCACACAAACCTGGG - Intronic
1165186257 19:34024879-34024901 GAGCATACTTACACTAACCTAGG - Intergenic
1167654061 19:50751936-50751958 GAGTGTGCTTACACAAACCTAGG - Intergenic
1168478492 19:56696298-56696320 GAGTGTACTTACACAAACCTTGG + Intergenic
925255248 2:2479198-2479220 GAGTAGACTCACCCCAAGCCAGG - Intergenic
925717976 2:6802387-6802409 GTGTATGTTAACACCAACCTTGG - Intergenic
927732254 2:25484145-25484167 GAGTGTACTTACACAAACCTAGG - Intronic
928152883 2:28848008-28848030 TAGTGTACTTACACAAACCTAGG - Intronic
929193112 2:39158163-39158185 GAGTATACACAAACCGATCTAGG - Intergenic
929583060 2:43096255-43096277 GAGTGTACTTACACAAACTTAGG - Intergenic
930490776 2:52067553-52067575 GAGCATACTTACACAAACCTAGG - Intergenic
930901403 2:56511448-56511470 AAGTAAACACACACCAACCTGGG - Intergenic
930975831 2:57459705-57459727 AAGTATGCTCCCACAAACCTAGG + Intergenic
932081230 2:68717061-68717083 GAATATACTTACACAAAACTAGG + Intronic
932141702 2:69284305-69284327 GAGTGTACTTACACAAACCTAGG - Intergenic
933425021 2:82099662-82099684 GAGTGTACTTACACAAACCTAGG - Intergenic
933844003 2:86310458-86310480 GAGTGTACTTACACAAACCTAGG - Intronic
934877093 2:97933106-97933128 GAGTGTACCTACACAAACCTAGG - Intronic
935083260 2:99820177-99820199 GAGTGCACTTACACAAACCTGGG + Intronic
935465089 2:103387100-103387122 GAGTATATTTACACAAATCTAGG - Intergenic
936748995 2:115617698-115617720 GAGTGTACTTACACAAACCTAGG - Intronic
937595730 2:123670500-123670522 GAGTGTACTTACACAAATCTAGG + Intergenic
937704914 2:124909397-124909419 GAGTGTGCTCACACAATCCTAGG - Intronic
938113311 2:128585718-128585740 GAGTGTACTTACACAAACATAGG + Intergenic
938710411 2:133971722-133971744 GAGTGTACTCACACAAACCTAGG + Intergenic
941470338 2:165877579-165877601 GAGTATACTTACACAAACCTAGG - Intronic
942049436 2:172125206-172125228 GAGTGTACTTACACAAACCTAGG - Intergenic
942881428 2:180866136-180866158 AAGTATACTTACACAAACCTAGG + Intergenic
942920612 2:181369211-181369233 GAGTGTACTCACACAAACCCAGG - Intergenic
943206452 2:184903496-184903518 GAGTGTACTTACACAAACCTAGG - Intronic
944385587 2:199160428-199160450 GATTATACTCACAATAACCTTGG - Intergenic
944388660 2:199193585-199193607 GAGTGTACTTACACAACCCTAGG - Intergenic
946233995 2:218311019-218311041 GTGTGTACTTACACAAACCTAGG - Intronic
947047199 2:226001302-226001324 GAATGTACTTACACAAACCTAGG + Intergenic
948330204 2:237158482-237158504 GAGTGTACTTACACAAACCTAGG - Intergenic
1169368358 20:5009418-5009440 GAGTATACTTGCACCAGCCTAGG - Intronic
1170774462 20:19363618-19363640 AAATACACTCACACCAACCCTGG + Intronic
1171564111 20:26162700-26162722 GATAATTCTCACACAAACCTAGG - Intergenic
1172492777 20:35354110-35354132 GAGTATACTTACACAAACCTCGG - Intronic
1172892389 20:38275818-38275840 CAGTGTACTTACACAAACCTAGG + Intronic
1173117667 20:40261411-40261433 GAGTGTATTTACACAAACCTAGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177065608 21:16430125-16430147 GAGTATAGTAACACCAACGGTGG - Intergenic
1177627715 21:23685347-23685369 GTTTATACTCACACCATACTTGG - Intergenic
1179323340 21:40314695-40314717 CAGCATACTCAGACAAACCTTGG + Intronic
1180020964 21:45126727-45126749 GAGTACACTCATACCAACTGAGG - Intronic
1180133197 21:45841102-45841124 GAATATACTTACCCAAACCTAGG - Intronic
1182979788 22:34658022-34658044 GAGTGCACTTACACAAACCTAGG + Intergenic
1183118098 22:35707420-35707442 GAGTATATTTACACAAACCTAGG - Intergenic
949418755 3:3841975-3841997 GAGTATACTTACATAAACCTAGG + Intronic
950852200 3:16072873-16072895 AAGTACACTTACACAAACCTAGG - Intergenic
951067241 3:18280926-18280948 GAGTGTACTCACACAAATGTAGG - Intronic
951527300 3:23665690-23665712 GAGTGTACTTACACAAACCTTGG + Intergenic
953678556 3:45022178-45022200 GAGTGTACTTACACAAACCTAGG + Intronic
954224215 3:49172162-49172184 GAGTATCCTTACAACATCCTGGG - Intronic
956783851 3:72625885-72625907 GAGTGCACTTACACAAACCTAGG + Intergenic
956863190 3:73344902-73344924 GATTGTACTCACACAAACCTAGG + Intergenic
957021121 3:75127764-75127786 GAGTGTACTTACACAAACCTAGG - Intergenic
957315968 3:78577308-78577330 GAGTGTACTTACACAAGCCTAGG - Intergenic
957960823 3:87249046-87249068 GAGTATACTTACATAAACCTAGG + Intronic
959918877 3:111848944-111848966 GAGTCCACTTACACAAACCTAGG - Intronic
962028843 3:131577400-131577422 GAGTATACTTACACAAACCTAGG + Intronic
962350032 3:134649978-134650000 GTGCATCCTCACACCAGCCTCGG + Intronic
964143186 3:153426977-153426999 GAGTACACTTACACAAACCTAGG - Intergenic
964600376 3:158494149-158494171 GAGTATACTCTCACAAACCTAGG + Intronic
964770165 3:160216345-160216367 GAGTGTACTTACACAAATCTAGG + Intergenic
967547209 3:190745356-190745378 GATTGTACTTACACAAACCTGGG - Intergenic
969396071 4:6922284-6922306 GACTCTACTCACTCAAACCTCGG + Intronic
969937262 4:10694621-10694643 GAGTGTATTTACACAAACCTAGG - Intergenic
970512029 4:16790540-16790562 GAGTGTACGTACACAAACCTAGG - Intronic
970672973 4:18417399-18417421 GAGTGTACTTACACAAACCTAGG + Intergenic
970797593 4:19932060-19932082 GAGTATACTTACAGAAACCTGGG + Intergenic
971212022 4:24627534-24627556 GAGTGTACTTACATCAACCTAGG + Intergenic
973725282 4:53769564-53769586 GAGCATACTGACACAAACCTAGG - Intronic
973953862 4:56043353-56043375 GAGTGTACTTACACAAACCTAGG + Intergenic
974139733 4:57870234-57870256 GAGTGTACTTACACAAACCTAGG - Intergenic
975077659 4:70232501-70232523 GAGTGTCCTTACACAAACCTAGG - Intronic
976628526 4:87212878-87212900 GAGTATACTTACACAAACCTAGG - Intronic
977779848 4:100968200-100968222 GAGTGTACTTACACAAACCTAGG - Intergenic
978229358 4:106379798-106379820 GAGTGTACTTACACAAATCTAGG - Intergenic
978347338 4:107785637-107785659 GTTTAAACACACACCAACCTTGG - Intergenic
978624882 4:110673967-110673989 GAGTGTACTTACACAAACCTAGG - Intergenic
980578728 4:134720198-134720220 GAGTGTACTCACACAAACCTAGG - Intergenic
980935107 4:139218914-139218936 AAGCAAACACACACCAACCTGGG + Intergenic
981343545 4:143649449-143649471 AAATATACTCATACCAACCCAGG + Intronic
981798837 4:148632405-148632427 GAGTATACTCACACAAACCTAGG + Intergenic
983932511 4:173468369-173468391 GAGTGTACTTACACAAACCTAGG - Intergenic
984130906 4:175874966-175874988 CAGTATACACACACACACCTTGG - Intronic
984352365 4:178612326-178612348 GAGTGTACTTACATGAACCTAGG + Intergenic
987901379 5:24016548-24016570 GAATATACTTACACAAACCTAGG + Intronic
991400767 5:66249096-66249118 GAGTATACTTACACAAATCTAGG + Intergenic
991769380 5:70026204-70026226 GAGTATTATCATACCAATCTAGG - Intronic
991848675 5:70901622-70901644 GAGTATTATCATACCAATCTAGG - Intronic
991939096 5:71832936-71832958 GAGTGTACTTACACAAACCTAGG - Intergenic
994210086 5:97078045-97078067 GAGTGGACTTACACAAACCTAGG + Intergenic
994638139 5:102368320-102368342 GAGTGTACTTATACAAACCTAGG - Intergenic
996920863 5:128765915-128765937 GAGTTTACTCAGGCCAGCCTGGG + Intronic
998117112 5:139546573-139546595 GAGAATAATCACATGAACCTGGG - Intronic
998212803 5:140213810-140213832 TAGTGTACTTACACAAACCTAGG - Intronic
998297745 5:140987741-140987763 GAGAATACTCAGAACAACCTGGG - Intronic
998899068 5:146832868-146832890 GAGTGTACTTACACAAACCTGGG - Intronic
999437708 5:151576836-151576858 GAGTGCACTTACACAAACCTAGG + Intergenic
999512863 5:152270896-152270918 GAGCATATTTACACAAACCTAGG + Intergenic
1002871958 6:1174859-1174881 GAGTGAACTTACACAAACCTAGG - Intergenic
1002980821 6:2135951-2135973 CAGTATACTTGCACAAACCTAGG + Intronic
1003676919 6:8213303-8213325 GAGTGTACTTACACAAATCTAGG + Intergenic
1004712309 6:18183805-18183827 GAGAATACACACACCAAGGTAGG - Intronic
1005698192 6:28371293-28371315 GAGTGTACTTACACAAACTTAGG - Intergenic
1006026190 6:31148600-31148622 TAGTAGGCTGACACCAACCTTGG + Exonic
1006960263 6:37922602-37922624 GAGTGTCCTTACACAAACCTAGG + Intronic
1007613300 6:43164751-43164773 CACTACACTCACTCCAACCTGGG + Intergenic
1008067671 6:47067211-47067233 GAGTGTACCTACACAAACCTAGG - Intergenic
1008803427 6:55398052-55398074 GAGTGTACTTACACCAACCTGGG - Intronic
1009850447 6:69190945-69190967 GAGTGTACTAATACAAACCTGGG - Intronic
1012114887 6:95284610-95284632 GGGTATACTTACACAAACCTAGG - Intergenic
1012183819 6:96188979-96189001 TCGTATACTCACACAAATCTAGG + Intronic
1012266540 6:97151416-97151438 GAGTGTACTTATACAAACCTAGG - Intronic
1013238431 6:108220549-108220571 GAGTATACTCACACAAACCCAGG - Intronic
1013887869 6:114992233-114992255 GAGTGTATTTACACAAACCTAGG - Intergenic
1013968061 6:115979880-115979902 AAGTGTACTCACACAAACCTAGG - Intronic
1014978109 6:127914466-127914488 GAGTGTGCTTACACAAACCTAGG + Intronic
1015781231 6:136868186-136868208 GAGTGTACTTACACAAACCTAGG - Intronic
1016349222 6:143149006-143149028 GAGTGTACTTACACAAACCTAGG - Intronic
1016608234 6:145959491-145959513 GAGTATACTTACACAAACCTAGG - Intronic
1017814695 6:158008353-158008375 GAATTTACTCACAATAACCTAGG + Intronic
1018461555 6:164004065-164004087 GAGTATACTCAAACCATGCATGG + Intergenic
1018558100 6:165071052-165071074 GAGTGTACTTAAACAAACCTAGG + Intergenic
1020866299 7:13568369-13568391 CAGTATTCTGAGACCAACCTGGG - Intergenic
1021354565 7:19637895-19637917 AAGTATATTAACACAAACCTAGG + Intergenic
1021880311 7:25089034-25089056 CAGTGTACTTACACAAACCTAGG - Intergenic
1023518618 7:41028496-41028518 GAGTGCACTTACACAAACCTAGG + Intergenic
1024107784 7:46110266-46110288 GGGCATACCCACACCATCCTGGG + Intergenic
1024665061 7:51537809-51537831 GAGTGGACTTACACAAACCTAGG - Intergenic
1025273617 7:57551512-57551534 GATGATTCTCACACAAACCTAGG + Intergenic
1027798668 7:82724475-82724497 GAGTGAACTTACACAAACCTAGG + Intergenic
1027830956 7:83177122-83177144 GAGTATCCTCACTCTAACCATGG + Intergenic
1028681685 7:93542187-93542209 CAGTGTACTTACACAAACCTAGG + Intronic
1030200071 7:106893817-106893839 GAGTGAACTTACACAAACCTAGG + Intronic
1030481438 7:110109687-110109709 GAGCTTACTTACACAAACCTAGG - Intergenic
1031030138 7:116725578-116725600 GAGTGTACTTATACTAACCTAGG + Intronic
1031226496 7:119045219-119045241 GAGTGTACTTACACAAATCTAGG + Intergenic
1031413594 7:121468809-121468831 GAGTTTACTTACACAAACTTAGG + Intergenic
1031507536 7:122604933-122604955 GAGTGTACTTATACAAACCTAGG + Intronic
1031846567 7:126812324-126812346 GACTGTACTTACACAAACCTAGG + Intronic
1031936953 7:127745172-127745194 GTGCATACTCACACAAACCTAGG + Intronic
1032565608 7:132939546-132939568 GAGTGTACTTACACAACCCTAGG - Intronic
1033059531 7:138092506-138092528 GAGTGTACTTACACAAACCGAGG + Intronic
1033398498 7:140998975-140998997 GAGTGTACTTACACAAACCTAGG + Intergenic
1033679165 7:143576345-143576367 GAGTGTACTTACAGAAACCTAGG + Intergenic
1033692672 7:143753109-143753131 GAGTGTACTTACAGAAACCTAGG - Intergenic
1034786133 7:153927697-153927719 GAGTATAATCCAACCACCCTAGG + Intronic
1035936336 8:3845280-3845302 GAGTGAACTCACAGAAACCTAGG + Intronic
1035941016 8:3901092-3901114 AAGTATACACACATTAACCTTGG - Intronic
1037870605 8:22492061-22492083 GAGTGTACTTACATAAACCTAGG + Intronic
1038597031 8:28896750-28896772 GAGTGTACTTACACAAGCCTAGG - Intronic
1040700276 8:50055215-50055237 AAGTATTCTCTCACCAACTTGGG - Intronic
1041777095 8:61535289-61535311 GAATATATTCACATCAACATAGG + Intronic
1043889330 8:85639211-85639233 GTTTACACTCCCACCAACCTAGG - Intergenic
1043946951 8:86264317-86264339 GAGTGTACTTACACAAATCTAGG + Intronic
1044105891 8:88206395-88206417 GAGAAAACTCACACAAACATGGG - Intronic
1044517355 8:93154988-93155010 GATTATACTCACAGCTCCCTAGG + Intronic
1044974364 8:97649122-97649144 TAGTATACTGACACAAACCTAGG - Intronic
1046950132 8:120012298-120012320 GAGTGTACTTACACAAACCTGGG + Intronic
1047247572 8:123158538-123158560 GAATATCCGCACACCCACCTAGG - Intergenic
1047822265 8:128534302-128534324 GAGTGGACTCACACAAACCTAGG - Intergenic
1048089858 8:131227701-131227723 GAGTGTACTTACACAAATCTAGG + Intergenic
1048562969 8:135562426-135562448 GAGTGTACTTACATAAACCTAGG - Intronic
1048929422 8:139299842-139299864 GAAGGTACTCACACAAACCTAGG + Intergenic
1049828425 8:144685168-144685190 GAGCACACTCACACCCCCCTGGG + Intergenic
1049828465 8:144685301-144685323 GGGCACACTCACACCCACCTAGG + Intergenic
1050770548 9:9193491-9193513 GAGTGTACTTACACAAACTTAGG + Intronic
1051075244 9:13225736-13225758 GGGTATACTTACCCAAACCTTGG - Intronic
1051647344 9:19281743-19281765 GAGTGTACATACACAAACCTAGG + Intronic
1052327396 9:27230257-27230279 GAGTATACTCGCACTACTCTAGG - Intergenic
1053050097 9:34954329-34954351 GAGTATAATTGCACCAACTTTGG + Intergenic
1056242475 9:84661807-84661829 GAGTACACTTACACAAACTTAGG + Intergenic
1056404386 9:86259952-86259974 AATTATACTCACGCCAGCCTGGG - Intergenic
1056751564 9:89355369-89355391 GAGGATGCTCACACCACCCTGGG - Intronic
1058633191 9:107010106-107010128 AAGTATGCTCTCACCTACCTGGG - Intronic
1059951558 9:119468291-119468313 GAGTGTACTTACACAAACTTAGG - Intergenic
1203625305 Un_KI270750v1:12163-12185 GATGATTCTCACACAAACCTAGG + Intergenic
1185696141 X:2196159-2196181 GAGCACACTCGCACAAACCTAGG + Intergenic
1185938203 X:4282867-4282889 GAGTGCACTTACACAAACCTAGG + Intergenic
1186013010 X:5158120-5158142 GAGTGCACTTACACAAACCTAGG - Intergenic
1186071992 X:5831607-5831629 GAGTGTACTTACACAAATCTAGG - Intergenic
1187008759 X:15258132-15258154 GAGTATTCTAATACCTACCTAGG - Intronic
1188371859 X:29379173-29379195 GAGTACATTCACAGCAGCCTGGG - Intronic
1188442513 X:30226918-30226940 GAGTATACTTACATAAACCTAGG - Intergenic
1188739705 X:33763618-33763640 GAGAATCTTCACACCTACCTAGG - Intergenic
1191011558 X:55764727-55764749 GAGTATACGTACACAAACCTAGG - Intergenic
1194413718 X:93585023-93585045 GAGTGTACTTACAGGAACCTAGG + Intergenic
1194496684 X:94624620-94624642 GAGTGTATTTACACAAACCTAGG + Intergenic
1197138208 X:123087469-123087491 AAGTATACTTGCACAAACCTAGG - Intergenic
1197645088 X:129008753-129008775 GAGTGTACTTACACAAACCTAGG + Intergenic
1200783576 Y:7238568-7238590 CATTACACTCACTCCAACCTGGG + Intergenic
1201523863 Y:14908801-14908823 GAGTGTACTTACACAAATCTAGG + Intergenic
1201757716 Y:17504852-17504874 GAATGTACTTACACAAACCTAGG - Intergenic
1201843838 Y:18401130-18401152 GAATGTACTTACACAAACCTAGG + Intergenic