ID: 1118356258

View in Genome Browser
Species Human (GRCh38)
Location 14:65016426-65016448
Sequence GAGCCCATGCTGCCTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118356258_1118356260 11 Left 1118356258 14:65016426-65016448 CCACTGAGAGGCAGCATGGGCTC 0: 1
1: 0
2: 2
3: 37
4: 275
Right 1118356260 14:65016460-65016482 TCGAATTTCTCAGCTTCCTCTGG 0: 1
1: 0
2: 0
3: 30
4: 219
1118356258_1118356261 22 Left 1118356258 14:65016426-65016448 CCACTGAGAGGCAGCATGGGCTC 0: 1
1: 0
2: 2
3: 37
4: 275
Right 1118356261 14:65016471-65016493 AGCTTCCTCTGGTGCTCTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118356258 Original CRISPR GAGCCCATGCTGCCTCTCAG TGG (reversed) Intronic
900179031 1:1303347-1303369 GAGCTCTTCCTGCCTCTGAGTGG - Intronic
901879026 1:12183094-12183116 GAGCACCTGCTACCTCCCAGGGG - Intronic
903646952 1:24901734-24901756 GGGCCAATGCTGCCTCTCTCTGG + Exonic
904701890 1:32362648-32362670 CAGCTCATGCTGCCTCTGAGAGG - Exonic
906511350 1:46411972-46411994 CAGGCAGTGCTGCCTCTCAGAGG - Intronic
910206547 1:84754151-84754173 GAATGCATGCTGTCTCTCAGCGG - Intergenic
912711613 1:111953980-111954002 TAGCCCATGGTGCCTCCCTGTGG - Intronic
912777638 1:112515804-112515826 GAGCCAGTGCTGGCACTCAGTGG + Intronic
912947398 1:114096453-114096475 GAGCACATGCTGCCTGTCTAGGG + Intronic
913340933 1:117757616-117757638 TGGCCCATGCTGCCCCTCACAGG + Intergenic
914447996 1:147766436-147766458 GGGGCCATGCTGCATGTCAGTGG + Intronic
914891599 1:151629118-151629140 GAGCCAATGCTGCCTAAAAGTGG - Intronic
916418900 1:164618016-164618038 CGGCCTATGCTGCCTCCCAGTGG + Intronic
922423091 1:225472208-225472230 GAGCCAGTGCTGCCCATCAGAGG - Intergenic
922500772 1:226095471-226095493 CAGTCCCTGCTGCCTCTCTGAGG - Intergenic
922609850 1:226918288-226918310 GACCACATGCTGGCTCTTAGTGG + Intronic
922754097 1:228084986-228085008 GGGCCCATACTGTCTCTCATAGG + Intronic
922947809 1:229531635-229531657 GAGCCCAAGCTGCCTTTTAACGG - Exonic
923069424 1:230549203-230549225 GAGCGGCTGCTGCCTTTCAGGGG + Intergenic
1062963142 10:1588854-1588876 GAGGCCATGCTGCCTCTGTCAGG - Intronic
1065483149 10:26214200-26214222 GAGCCCATTCCCCCTCTCCGGGG - Intergenic
1067344755 10:45429100-45429122 GAACCCATGGTGCCCCTCAGTGG - Intronic
1068638511 10:59374893-59374915 GAGCACATGCTGTCAGTCAGTGG - Intergenic
1069247132 10:66220382-66220404 CAGCCCCTGCACCCTCTCAGGGG - Intronic
1069621589 10:69840757-69840779 GATCCCAGGTTTCCTCTCAGGGG - Intronic
1070982098 10:80657349-80657371 GGGCACAAGCTGCCTCTCAGAGG - Intergenic
1071503585 10:86219883-86219905 CAGCCCAGGCTGCCTCCCGGGGG - Intronic
1073512190 10:104049605-104049627 GAGCCCATGCCACTTCCCAGGGG - Intronic
1074879839 10:117647325-117647347 CTGTCCATGCTGCTTCTCAGTGG - Intergenic
1075964069 10:126595333-126595355 AAGCACATTCTGCATCTCAGTGG - Intronic
1077159723 11:1107280-1107302 GGGCCCATGCCACCTCTCAGGGG + Intergenic
1077282323 11:1751281-1751303 GACCCCTGGCTCCCTCTCAGTGG - Intronic
1077414908 11:2420435-2420457 CAGCCCAAGCTGCCTCTCGAGGG - Intronic
1079375739 11:19890264-19890286 TACACCATGCTGCCTCACAGAGG + Intronic
1083254184 11:61486293-61486315 GGGCCCAGGCTGCCTCTGCGGGG + Intronic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1084625005 11:70299719-70299741 GCTCCCCTGCTGCCACTCAGAGG + Intronic
1086282853 11:85210753-85210775 GAGCCCAAGTTGCCTATTAGAGG - Intronic
1089680464 11:120116419-120116441 GACCGCATGCAGCCTCTCACTGG - Intronic
1089736809 11:120555321-120555343 TGGCCCTTGCTGCCTCACAGTGG - Intronic
1090744605 11:129696039-129696061 CAGCCCCGGCTTCCTCTCAGTGG - Intergenic
1091618754 12:2069506-2069528 GACCACATGCTGTCTTTCAGGGG - Intronic
1091646218 12:2274221-2274243 GGGCCCAGGCGTCCTCTCAGAGG + Intronic
1091665973 12:2418813-2418835 CAGCCCATGCTGACCCCCAGTGG + Intronic
1092018253 12:5177906-5177928 GAGCTCATGCTGACTCATAGGGG + Intergenic
1093583352 12:20807945-20807967 CAGCCCTTGCTCCCTCTCCGCGG - Intergenic
1096549300 12:52361601-52361623 GAGCCCTTCTTGCCTTTCAGGGG - Intronic
1096623618 12:52879693-52879715 GAGCCCCTGCTGCCTCGCGCCGG + Intergenic
1096799359 12:54099383-54099405 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1097815709 12:64071306-64071328 GAGCTCAGGATGGCTCTCAGTGG + Intronic
1098550900 12:71760125-71760147 GAACTCATGCTGTCTCTGAGGGG + Intronic
1098854374 12:75635711-75635733 GAGACAATGCTGCTTTTCAGCGG + Intergenic
1098949821 12:76628290-76628312 GAGGCCATGCTGCACCTCAGTGG - Intergenic
1099043580 12:77686951-77686973 GACTCAATGCTGCCTCTCGGTGG + Intergenic
1099443029 12:82721234-82721256 TTGCCCATGCTGTCTGTCAGTGG + Intronic
1103044352 12:117723058-117723080 GAGACCAGGCTGCCCCTCAGTGG + Intronic
1108113961 13:47107922-47107944 GAGCCCATACAGCATCTAAGAGG + Intergenic
1108433357 13:50377108-50377130 GGGACCCTGCTGCCTCCCAGTGG - Intronic
1108523290 13:51263479-51263501 GAGCCCCACATGCCTCTCAGGGG + Intronic
1110122190 13:71895882-71895904 GAGCCCATCCTGTCCCTCATAGG + Intergenic
1110519798 13:76462133-76462155 GAGTTCATACTGCCTCTCAAAGG + Intergenic
1113627869 13:111859604-111859626 GCGCCCTGGCTGTCTCTCAGCGG + Intergenic
1113708571 13:112449388-112449410 GAGCCCAGTCTCCCTCTCTGTGG - Intergenic
1113762909 13:112862667-112862689 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113762947 13:112862883-112862905 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113762965 13:112862991-112863013 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113762993 13:112863153-112863175 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763003 13:112863207-112863229 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763022 13:112863315-112863337 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763054 13:112863477-112863499 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763072 13:112863585-112863607 CGGCCCATGCAGCTTCTCAGCGG + Intronic
1113763080 13:112863639-112863661 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763107 13:112863802-112863824 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1113763149 13:112864072-112864094 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1113763213 13:112864450-112864472 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763275 13:112864774-112864796 CGGCCCATGCAGCTTCTCAGCGG + Intronic
1113763283 13:112864828-112864850 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763327 13:112865099-112865121 CAGCCCATGCAGCTTCCCAGCGG + Intronic
1113763377 13:112865370-112865392 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1113763384 13:112865424-112865446 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1113771732 13:112914034-112914056 GAACCCAGGCTGGCTCACAGGGG - Intronic
1113916114 13:113875057-113875079 GAGCCCATGCCTCATCTCCGTGG - Intergenic
1114073412 14:19132790-19132812 GCGCCCAGGCCGCCTCTCAGCGG + Intergenic
1114088854 14:19267193-19267215 GCGCCCAGGCCGCCTCTCAGCGG - Intergenic
1114364505 14:22012436-22012458 GTGCCCATGCAGGCTCTCTGGGG + Intergenic
1114709648 14:24765617-24765639 AAGCCCATGCTGTCTCTTTGTGG - Intergenic
1115652289 14:35411392-35411414 GAGCTCATGATCCTTCTCAGAGG + Intergenic
1117584150 14:57182978-57183000 GATGCCACACTGCCTCTCAGAGG + Intergenic
1118002470 14:61536435-61536457 CAGCTCTTCCTGCCTCTCAGGGG - Intronic
1118356258 14:65016426-65016448 GAGCCCATGCTGCCTCTCAGTGG - Intronic
1118468316 14:66052076-66052098 AAGCCCATCCTTTCTCTCAGGGG - Intergenic
1118895741 14:69943887-69943909 AAGCCCTTTCTGCCCCTCAGTGG + Intronic
1119419719 14:74501342-74501364 GAGCCACTGCTGCCTCCTAGTGG - Intronic
1119873798 14:78039018-78039040 GAGCCCAGGCTGCAACCCAGAGG - Intergenic
1121044290 14:90776759-90776781 GACCCCATTCTGCCACTCAGAGG + Intronic
1121720242 14:96104177-96104199 GACCCCCTGCTCCCTCTCATGGG - Intergenic
1123206995 14:106723517-106723539 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123207340 14:106726240-106726262 AAGTCAGTGCTGCCTCTCAGGGG - Intergenic
1123212014 14:106770520-106770542 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123661865 15:22571699-22571721 GAGCCCCTGCAGCCTTCCAGCGG + Intergenic
1123935396 15:25191629-25191651 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123938042 15:25203435-25203457 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123939950 15:25212006-25212028 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123942514 15:25223457-25223479 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123943365 15:25227317-25227339 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123943761 15:25229176-25229198 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1124262345 15:28203846-28203868 GAGCCCCTGCAGCCTTCCAGCGG - Intronic
1124315664 15:28665942-28665964 GAGCCCCTGCAGCCTTCCAGCGG + Intergenic
1124374202 15:29120393-29120415 CCACCCATGCTGACTCTCAGAGG - Exonic
1128565498 15:68698229-68698251 CAGCCAATGCTGTCTCCCAGTGG + Intronic
1129586836 15:76875973-76875995 GGGCCTTTGCTGCCTCCCAGCGG - Intronic
1132342498 15:101087328-101087350 GAGCCCAGCCTGCCCATCAGTGG + Intergenic
1132576700 16:667583-667605 CAGTCCCTGCTGCATCTCAGAGG - Exonic
1132601053 16:773147-773169 GACCACATGCTGGCACTCAGTGG + Exonic
1135930005 16:26728220-26728242 GAGACCAGGCTGTCTCTCACTGG - Intergenic
1136708760 16:32215402-32215424 GAGCCCATTATACCACTCAGTGG - Intergenic
1136759146 16:32714006-32714028 GAGCCCATTATACCACTCAGTGG + Intergenic
1136772002 16:32848191-32848213 GAACCCAGGCTGCGTCTCAGTGG + Intergenic
1136808961 16:33156380-33156402 GAGCCCATTATACCACTCAGTGG - Intergenic
1136815437 16:33266460-33266482 GAGCCCATTATACCACTCAGTGG - Intronic
1136898608 16:34013330-34013352 GAACCCAGGCTGCGTCTCAGTGG - Intergenic
1137609546 16:49809654-49809676 GACCACATGCTGGCTCCCAGAGG + Intronic
1138365766 16:56475413-56475435 GATCCCATGCTGCTTAACAGTGG - Intronic
1138498731 16:57425247-57425269 GGGCCCATTCTGCAGCTCAGGGG + Intergenic
1139112408 16:63906780-63906802 GTTCCCATCCTGCCTCTAAGAGG - Intergenic
1139593908 16:67947459-67947481 GAGCCCCTGGTGCCGCCCAGGGG + Intronic
1139852646 16:69960303-69960325 GACCCCACGCTGCCCCCCAGAGG - Intronic
1139881617 16:70183211-70183233 GACCCCACGCTGCCCCCCAGAGG - Intronic
1140370891 16:74412294-74412316 GACCCCACGCTGCCCCCCAGAGG + Intronic
1142066343 16:88065175-88065197 AAGCCCATCCTGGGTCTCAGTGG + Intronic
1142201855 16:88764906-88764928 AAGCCCTTGTTGCCTCTCTGGGG - Intronic
1203061305 16_KI270728v1_random:974317-974339 GAGCCCATTATACCACTCAGTGG + Intergenic
1203074423 16_KI270728v1_random:1110280-1110302 GAACCCAGGCTGCGTCTCAGTGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1145795440 17:27652917-27652939 GAGCTCAGTCTGCCTCTCTGTGG - Intergenic
1146917851 17:36689565-36689587 GAGCCCACCCTGCCTCTGTGGGG - Intergenic
1147513729 17:41096358-41096380 CAGCCCACTCTGCCTCTCAAAGG + Intronic
1150483737 17:65530313-65530335 CAGCCCAGGCTGCTGCTCAGTGG - Intronic
1151216735 17:72582234-72582256 CAGCCCCTGCTGCCTGTCAGTGG - Intergenic
1152247088 17:79190601-79190623 GAGACCCTGCTGTCTCTCCGGGG + Intronic
1152278415 17:79371482-79371504 GACCCCATGCAGTCTATCAGGGG + Intronic
1152630142 17:81407234-81407256 GAGCCCAGCCTGCTGCTCAGAGG - Intronic
1152799503 17:82324238-82324260 GAGCCCAGTCTGCCTGTCAGGGG - Intronic
1153687687 18:7562889-7562911 GAGCCCATCCTGCCAGTCGGTGG - Intergenic
1154331910 18:13437030-13437052 GAGCCCAGCCTGCCTCTCAGCGG - Intronic
1155359174 18:24982972-24982994 GAACCCAGGCTTCCTCACAGAGG - Intergenic
1155625657 18:27831714-27831736 GAGTTCATGCTGCATCTCTGTGG + Intergenic
1157119501 18:44895625-44895647 TACCCCATGCTGCCTCCCAGTGG + Intronic
1157548161 18:48562405-48562427 TGGGCCATGCTGCCTCTCACTGG + Intronic
1157976420 18:52332782-52332804 GAACCCATGCTGGCTCCCAGTGG + Intergenic
1158552919 18:58452129-58452151 GAACCCATTCTGTCTCTGAGAGG + Intergenic
1160533296 18:79577720-79577742 GAGCCCAGCCTTCCTCTCACTGG + Intergenic
1160708701 19:540998-541020 GGGCCCATGCTGCCCCACTGGGG - Intronic
1161120059 19:2520769-2520791 GCGCCCCTGCTGCCACCCAGAGG - Intronic
1161455878 19:4369552-4369574 GACCACATCCTGCCTCTGAGGGG + Intronic
1162441932 19:10697950-10697972 CAGCCAATGTTGCCTCTCAGTGG - Intergenic
1165076724 19:33283464-33283486 GAGCCCACGCTGCCTGTGAAGGG + Intergenic
1165905870 19:39194344-39194366 GAGCCCATGTTTCTTCCCAGGGG + Intergenic
1166511820 19:43414448-43414470 GAGGCCAAGCTGACTCCCAGAGG + Intronic
1166702742 19:44891530-44891552 GCGCCCAGGCTGCCTCCCAGCGG - Exonic
1167631691 19:50629731-50629753 GAGCCCTAGCTCCCTCTCTGTGG + Intronic
1167638369 19:50667734-50667756 GAGCCAGTGCTGCGTCTCTGGGG - Exonic
1167730515 19:51250947-51250969 AAGCCCATGCAGCCTCTGATTGG + Intronic
1167730519 19:51250979-51251001 AAGCCCATGCAGCCTCTCATTGG + Intronic
927056877 2:19373550-19373572 GAGCCCATGCAGCAGCTCACAGG + Intergenic
930543280 2:52734675-52734697 GAACCCCTGCTGCCTCTGACAGG - Intergenic
931705310 2:64942102-64942124 GAGCCAAAGCTGGCCCTCAGAGG - Intergenic
932759773 2:74431575-74431597 CTGTCCATGCTGCCTCTCAGAGG + Intronic
934557200 2:95293766-95293788 GACTCCATGCTGTCTCTCACAGG - Intergenic
934709292 2:96504472-96504494 GAGCCCATGGTGCCCACCAGGGG + Intronic
936155727 2:110046488-110046510 GAGCCCAGGTGGCCTCTGAGGGG - Intergenic
936188961 2:110324945-110324967 GAGCCCAGGTGGCCTCTGAGGGG + Intergenic
936521183 2:113212956-113212978 TAGCCCCTGCTGCTTCTCAAGGG + Intergenic
937408074 2:121649137-121649159 GAGCCCAGGCTGCTTTGCAGAGG - Intronic
938487335 2:131724143-131724165 GCGCCCAGGCCGCCTCCCAGCGG + Intronic
938902079 2:135806996-135807018 GACCCCATGCTGCCCCTCCATGG + Intronic
938904679 2:135826636-135826658 GTGCCTCTGCTGCCTGTCAGAGG + Intronic
939329041 2:140734789-140734811 AAGCCAATGTTGCCTGTCAGAGG - Intronic
941465799 2:165825327-165825349 GAGCCCATGCTGCTGTTGAGAGG + Intergenic
941516425 2:166485972-166485994 TAGCCTGTGCTGCTTCTCAGCGG + Intronic
941723458 2:168836788-168836810 CATCCCATTCTGCCTCCCAGAGG + Intronic
941878637 2:170459950-170459972 GAACTCATGCTGGCTCTCAAGGG + Intronic
942190687 2:173465981-173466003 GAGGCCACTCTGCCTCTGAGAGG - Intergenic
946130255 2:217601137-217601159 TACCCCATGCTGCCCATCAGAGG + Intronic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
1168769676 20:407646-407668 GATCCGACGCTGCCTCTCAGCGG - Intronic
1169077145 20:2768269-2768291 CTGCCCCTGCTGCCTCTCTGGGG + Intergenic
1171184507 20:23115347-23115369 GAGCCCATGCTTCCATTTAGAGG - Intergenic
1171797072 20:29574957-29574979 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1171851178 20:30309207-30309229 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1172361052 20:34312666-34312688 GAGCCCGTGCTCCCTTTCTGTGG - Intergenic
1173815576 20:45985697-45985719 GTACCCAAGCTGCCTCCCAGAGG + Intergenic
1173892191 20:46521167-46521189 GTGCCAATGCTGCCACTTAGTGG - Intergenic
1176032180 20:63017894-63017916 GAGCCCAGGTTCCCTCTCTGTGG + Intergenic
1178534127 21:33398574-33398596 GAGCCCACACTGCCACTCATTGG + Intergenic
1179418400 21:41216567-41216589 GACCCGGTCCTGCCTCTCAGGGG - Intronic
1179876902 21:44273207-44273229 GAGCCCAAGGTGCCCCACAGGGG - Intergenic
1180079843 21:45481670-45481692 GTGGCCAGACTGCCTCTCAGAGG + Intronic
1180166537 21:46033617-46033639 GACCCCGTGCTGCCTCTCTGTGG - Intergenic
1180253584 21:46606429-46606451 GAGCTCAGGCTGCCACTCTGGGG - Intergenic
1180491854 22:15855143-15855165 GCGCCCAGGCCGCCTCTCAGCGG + Intergenic
1180790474 22:18573037-18573059 TTGCCCATGCTGCCTGGCAGAGG - Intergenic
1180971962 22:19820498-19820520 CACCCCATTCTGCCCCTCAGTGG + Intronic
1181231264 22:21422278-21422300 TTGCCCATGCTGCCTGGCAGAGG + Intronic
1181247387 22:21512590-21512612 TTGCCCATGCTGCCTGGCAGAGG - Intergenic
1181856303 22:25783765-25783787 GGGCCAAAGCTGCCTCTGAGAGG + Intronic
1182717063 22:32365469-32365491 GAACCCCTGCTTGCTCTCAGAGG + Intronic
1182995427 22:34807859-34807881 GAGCCTATTGTGCTTCTCAGAGG - Intergenic
1183014637 22:34975842-34975864 AAGCCCATGCTGCCAGTCCGTGG + Intergenic
1183252936 22:36743248-36743270 CTGCTAATGCTGCCTCTCAGAGG + Intergenic
1185057111 22:48586875-48586897 GAGCCCATCCTGCCATCCAGGGG - Intronic
1185058772 22:48594684-48594706 GAGGCCAGACTGCCACTCAGTGG + Intronic
950418561 3:12883063-12883085 GAGCCTTAGCTGCCTCCCAGCGG + Intergenic
950441576 3:13013940-13013962 GAGCCCCTGCTGCCTGCCTGGGG - Intronic
950959858 3:17094173-17094195 GAACCCAGGCAGCCTCTCAGTGG - Intergenic
950999187 3:17538323-17538345 GAGGCCATTTTGCCTCTTAGTGG - Intronic
951017660 3:17747444-17747466 GAGCCAAAGCTGCCTGTTAGAGG - Intronic
954987514 3:54808790-54808812 GAGCCACTGCTGCATCACAGTGG - Intronic
956272360 3:67461758-67461780 GGGGCCATGCTACCTCCCAGGGG - Intronic
956712701 3:72052089-72052111 GCTCCCATCCTGCCTCTCAAGGG + Intergenic
957405697 3:79773641-79773663 CAGGCCATGCTTCCACTCAGGGG - Intergenic
957885513 3:86282438-86282460 GGGCCTTTGCTGCCTCCCAGTGG + Intergenic
962448753 3:135493730-135493752 TAGCCCACCCTGCCTCCCAGTGG + Intergenic
962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG + Intronic
963991462 3:151661077-151661099 GGGACTATACTGCCTCTCAGTGG + Intergenic
967320826 3:188193277-188193299 CATGCTATGCTGCCTCTCAGTGG - Intronic
967863434 3:194170582-194170604 GGGCCCATGGTGCCCCACAGCGG - Intergenic
970040182 4:11787588-11787610 GAGCGCATGCTGCCTCTAAATGG + Intergenic
971448993 4:26782146-26782168 GAGTCCATCCTGCCTCTGCGGGG - Intergenic
972572945 4:40327272-40327294 GGGGCCATGCTGCTTCTAAGGGG + Intergenic
974841671 4:67306526-67306548 GAGCCCAAACCACCTCTCAGAGG + Intergenic
975891638 4:79036132-79036154 GCTTCCATGCTGCCTCTCAGTGG + Intergenic
979776156 4:124590638-124590660 CCTCCCATGCTTCCTCTCAGTGG + Intergenic
984404230 4:179306631-179306653 GAGCCGATGCTGCTTCTCTTAGG + Intergenic
984702698 4:182828327-182828349 GACGCCTGGCTGCCTCTCAGGGG + Intergenic
986412038 5:7490429-7490451 AAGGCCATTCTACCTCTCAGTGG - Intronic
988442836 5:31251264-31251286 GTGCCCATGATGCCTTACAGGGG - Intronic
988683016 5:33502186-33502208 GCGCCCAGGCCGCCTCCCAGCGG - Intergenic
988828007 5:34959430-34959452 AAGCCCATGCTGCTGCTCTGTGG - Intergenic
989632916 5:43505354-43505376 GAGCACCTGCTGCCGCTCACTGG - Intronic
991551596 5:67842927-67842949 GAGCCCATCCTGCCCCTGAGGGG + Intergenic
992191656 5:74297955-74297977 GAGCCCCAGAAGCCTCTCAGGGG - Intergenic
993096806 5:83488476-83488498 GAGCTTATCCTTCCTCTCAGTGG + Intronic
998155173 5:139782064-139782086 GAGCCCATGTGGGCTCCCAGTGG + Intergenic
998181822 5:139951436-139951458 CACCCCCTGCTGCCTCTCTGGGG + Intronic
999250551 5:150179911-150179933 GAGCTCTTGCTGCCTCTCCAGGG - Intronic
1001256059 5:170184233-170184255 GAGCTCATGCTGCCCCCTAGAGG + Intergenic
1001593075 5:172879718-172879740 GATCCCATGCTCTCTCTGAGGGG - Intronic
1001868930 5:175133376-175133398 GAAACCAGGCTGCCTCCCAGTGG - Intergenic
1002290327 5:178196036-178196058 GAGCCACTGCTGCCTCTCAGAGG + Intergenic
1002538384 5:179890866-179890888 GAGCCAATGCAGCCTCACAGGGG + Intronic
1002594931 5:180315871-180315893 GTGCCCATGCTGCCCAGCAGGGG - Intronic
1003446737 6:6191751-6191773 GAGAAAATGCTGCTTCTCAGAGG + Intronic
1008771406 6:54983051-54983073 GAGCCCATTCTGCCTCTTCAGGG + Intergenic
1009967899 6:70596311-70596333 GAGCCAATGTTGCCCATCAGGGG - Intergenic
1017061748 6:150491138-150491160 GAGGCCATGCTGCCTTCCTGGGG + Intergenic
1017713414 6:157190305-157190327 GAGCCCATGCTGCATCGGTGTGG + Intronic
1018034092 6:159866904-159866926 GAGCCCGGGCTGGCTGTCAGCGG - Intergenic
1018239087 6:161754572-161754594 GGGTCCCTGCGGCCTCTCAGAGG + Intronic
1019910389 7:4096907-4096929 GAGCCCAGGCTGCCTCTTCCTGG - Intronic
1021818652 7:24475258-24475280 GAGTCCATGCTCCCTCTCTTGGG - Intergenic
1024116636 7:46200402-46200424 TAGCACATTCTGCCTCTTAGAGG + Intergenic
1024318434 7:48042890-48042912 GAGCACAGGCTCCTTCTCAGAGG - Intronic
1024961481 7:54981351-54981373 GGGTCCTTGCTGGCTCTCAGTGG + Intergenic
1026742826 7:72989915-72989937 GAGCCCTTTCTGTCTCTCAGCGG + Intergenic
1027028939 7:74874620-74874642 GAGCCCTTTCCGTCTCTCAGCGG + Intergenic
1027100909 7:75375163-75375185 GAGCCCTTTCTGTCTCTCAGCGG - Intergenic
1027239090 7:76315617-76315639 GATCCCGTGCTGCCGCTCAGTGG - Intergenic
1030680876 7:112432698-112432720 GAGCCCATGCTGCTTCCATGTGG + Intronic
1033420188 7:141198701-141198723 GAGCTCATGCTTTCTCTCTGGGG - Intronic
1035343704 7:158183548-158183570 GAAGCCATTCTGCCTCACAGGGG - Intronic
1035864185 8:3064106-3064128 CAGCTCAAGCTGCCTCTTAGAGG + Intronic
1036636861 8:10557091-10557113 GAGGACATGCTGGATCTCAGAGG + Intergenic
1036730722 8:11261711-11261733 CAGCCCACTCAGCCTCTCAGAGG - Intergenic
1038439290 8:27560379-27560401 GAGCCCATGCTGCCACTCCTGGG + Intergenic
1039409659 8:37342256-37342278 CAGCACGCGCTGCCTCTCAGGGG + Intergenic
1040758330 8:50808035-50808057 GAGTCCATGCTACCCCTCTGAGG + Intergenic
1043401970 8:79892486-79892508 GAGCTCAAGCTCCCTCTCTGAGG - Intergenic
1044451692 8:92342909-92342931 CAGCCCATGATGCCTCTCATAGG - Intergenic
1045187530 8:99854191-99854213 GTGCACAAGCTGCCTCGCAGTGG - Exonic
1045497453 8:102720380-102720402 GAGCTCAAGGTGTCTCTCAGAGG - Intergenic
1045552444 8:103184514-103184536 GAGACAATGCTGGCTCTGAGAGG + Intronic
1048021768 8:130546194-130546216 GCACACATGCTGCCTCTCAAAGG - Intergenic
1048594678 8:135853881-135853903 AAGGCCATGCTGCCACTAAGTGG + Intergenic
1049468647 8:142765232-142765254 CAGCCCATGCTCCTTCTCAGCGG + Intronic
1049852963 8:144843972-144843994 TAGCCCAGCCTGCCTCTCTGAGG - Intronic
1050073328 9:1839136-1839158 CAGACCATGCTGCTTGTCAGTGG + Intergenic
1052772641 9:32703713-32703735 GAGCCCACCCTACATCTCAGAGG + Intergenic
1052892854 9:33720055-33720077 CAGCCCCGGCTTCCTCTCAGTGG - Intergenic
1053162794 9:35825205-35825227 GAGCCCATGTGGCCTTTCAGAGG - Intronic
1053487914 9:38474417-38474439 CAGCCCATGCTGTCTGACAGTGG - Intergenic
1053788952 9:41672487-41672509 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1054156187 9:61642280-61642302 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1054177234 9:61883832-61883854 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1054475958 9:65573281-65573303 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1054660299 9:67696973-67696995 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1056495261 9:87149257-87149279 GATCCCAGGCTGCCTTTCTGGGG + Intronic
1056658377 9:88527081-88527103 GTGGCCATGCAGCCCCTCAGAGG + Intergenic
1057828935 9:98392514-98392536 GAGACCATTCTGGTTCTCAGAGG + Intronic
1057892133 9:98877314-98877336 GAGCCGACTCTGCCTCCCAGTGG + Intergenic
1060189369 9:121582354-121582376 GTCCCCATGCTGAGTCTCAGAGG + Intronic
1060527837 9:124330535-124330557 GGGCCCGTGCTGCCTCTTGGGGG + Intronic
1061038096 9:128124593-128124615 GAGCCCCTGGTGACTCCCAGCGG - Intronic
1061682347 9:132249253-132249275 GAGACCTTGCTGCCCCACAGGGG + Intergenic
1062272757 9:135717380-135717402 AGGCCCAAGCTTCCTCTCAGAGG - Intronic
1062624283 9:137435906-137435928 GGGCCCAGGCTGGCTCTTAGGGG - Intronic
1187581271 X:20610055-20610077 CAGCCAAGGCTGCCCCTCAGGGG - Intergenic
1189216559 X:39330120-39330142 GAGCCAAGGTTGCCTGTCAGAGG - Intergenic
1189295278 X:39913442-39913464 GAACCCTTGCTGCATCACAGAGG + Intergenic
1192201868 X:69071346-69071368 GAGCCCCAGCTGCTTCTGAGGGG - Intergenic
1194673216 X:96761325-96761347 AAACCAATGCTGCCTCTCAATGG - Intronic
1195364361 X:104112772-104112794 GAGCACATGCTGCCCACCAGTGG + Exonic
1195565727 X:106336922-106336944 GGGTCCATCCTGTCTCTCAGTGG + Intergenic
1197329674 X:125138221-125138243 GAGCCCGTGCTGTCTCCCTGAGG - Intergenic
1198145552 X:133853038-133853060 TACTCCATGCTGCCTCTCACTGG - Intronic