ID: 1118357989

View in Genome Browser
Species Human (GRCh38)
Location 14:65031243-65031265
Sequence ATGTGCCCCGAGAAGAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118357987_1118357989 5 Left 1118357987 14:65031215-65031237 CCATGACAGAGGGAGAAGCTGAA 0: 1
1: 0
2: 2
3: 41
4: 405
Right 1118357989 14:65031243-65031265 ATGTGCCCCGAGAAGAATTAGGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118357989 Original CRISPR ATGTGCCCCGAGAAGAATTA GGG Intronic
905083577 1:35348630-35348652 ATGTGCTCTGATAAGAATCACGG + Intronic
906928516 1:50145114-50145136 ATATGACCCAAGAAGAATTCAGG + Exonic
907554913 1:55335123-55335145 ATGTGCCCCCAGAAGTAGTTTGG - Intergenic
908054863 1:60274193-60274215 ATGTGCCCCACGAAGAAAAATGG + Intergenic
914927156 1:151898359-151898381 TTGTGTACCTAGAAGAATTATGG - Intronic
915490391 1:156247279-156247301 TTGTGCCCCCAGGAGAATTTTGG + Intronic
916128494 1:161591723-161591745 ATGAGCCATGAGAAGAATAAAGG - Intronic
916138411 1:161673554-161673576 ATGAGCCATGAGAAGAATAAAGG - Intronic
1063981133 10:11452757-11452779 AAGTGCCCCCAGATGAAATATGG - Intergenic
1064863285 10:19850970-19850992 ATGTAACCCCAGAAGATTTAAGG + Intronic
1067905190 10:50283260-50283282 ATGTCCCCAGAGAAGACTGATGG + Intergenic
1077549130 11:3192101-3192123 ATGTGGCCGGAGAAGAAGAAAGG - Intergenic
1078580137 11:12533161-12533183 ATGTGTCCTGAGAAGAGCTAGGG + Intergenic
1084805533 11:71576572-71576594 ATGTGCCAAGAGAAGCTTTAGGG - Intergenic
1090248429 11:125234464-125234486 ATGTGCATAGAGAAGAATGATGG - Intronic
1092759815 12:11799538-11799560 ATGTGACCCTAAAAGCATTAGGG + Intronic
1099055546 12:77835288-77835310 ATGTGCTCAGCTAAGAATTATGG + Intronic
1099175031 12:79411400-79411422 ATGTGCCCAGCTAAAAATTAGGG + Intronic
1099461303 12:82924899-82924921 ATGTGCCACGATAAGAAGTCTGG - Intronic
1102651278 12:114444235-114444257 CTGTGACCAGAGAAGCATTAAGG + Intergenic
1104592523 12:130096056-130096078 GTCTGCCCCGGGAAGGATTATGG + Intergenic
1106159009 13:27183918-27183940 ATTTGCCAGGTGAAGAATTAAGG - Intergenic
1110918064 13:81048095-81048117 ATGTGCCCCGAGTAAAATGTAGG + Intergenic
1115009743 14:28530767-28530789 ATGTGACCACAGAAGAATAATGG - Intergenic
1116836299 14:49771625-49771647 ATCTGCCTAGAGAAGAACTATGG + Exonic
1118357989 14:65031243-65031265 ATGTGCCCCGAGAAGAATTAGGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1127673042 15:61213658-61213680 AAATGCCCCGAGAGGAGTTAGGG - Intronic
1128419919 15:67482103-67482125 ATGTGGCCCAAGGACAATTATGG + Intronic
1129628218 15:77228826-77228848 ATGTGCCCCTAAAAGTATTGAGG + Intronic
1130000986 15:80046360-80046382 ATGTTCCCTGAGAGGCATTATGG + Intergenic
1134445924 16:14331347-14331369 GTGTGCCCCCTGAAGAAGTAGGG + Intergenic
1146307678 17:31743084-31743106 ATGTTCCCAGAGGAAAATTAGGG + Intergenic
1151258657 17:72899528-72899550 ATGTGGCCGGAGAGGAATTGTGG - Intronic
1153060725 18:992224-992246 AAGTGCCCCTAGAAAAATTAGGG - Intergenic
1156635381 18:39021505-39021527 ATTGGCCCCAAGAAGAATGATGG - Intergenic
933904915 2:86882434-86882456 TTGTACCCCCAAAAGAATTAGGG + Intergenic
936367313 2:111869728-111869750 TTGTACCCCCAAAAGAATTAGGG - Intronic
936772735 2:115934544-115934566 GTGTGTCCCTAGCAGAATTAAGG + Intergenic
937374070 2:121323314-121323336 ATTTACCCTGAGTAGAATTAGGG - Intergenic
939779833 2:146432191-146432213 ATGTGCCCCGAAAAGCAAAAAGG + Intergenic
943671134 2:190662342-190662364 ATGTACACCGTAAAGAATTATGG + Intronic
948268684 2:236657196-236657218 ATGTGCTCTGAGATAAATTATGG - Intergenic
1172268352 20:33637079-33637101 CTGTGCCCAGAGCAGAATTTGGG - Intronic
1173529082 20:43754728-43754750 ATGAGCCCAGAGAAGAACCAGGG - Intergenic
1184452131 22:44589460-44589482 ATGTGCCCCGGGAAGAGATCTGG - Intergenic
951636516 3:24784434-24784456 ATCTTCCCTGAGAAGAATTCTGG + Intergenic
954370405 3:50167029-50167051 ATGTGCCCCAAGAAGTATGAAGG - Intronic
955665316 3:61343849-61343871 ATGTGCCCAGATAAAAATCAAGG + Intergenic
972102763 4:35443495-35443517 CAGTGCCTCTAGAAGAATTAAGG - Intergenic
972869059 4:43273564-43273586 ATATCCCCTGAGAATAATTAAGG + Intergenic
973822525 4:54675439-54675461 ATGTCACCCAAGAAAAATTAAGG + Intronic
991469552 5:66953614-66953636 ATATTCCCCGAGAAGAAATGTGG + Intronic
992101732 5:73414561-73414583 ATGTGCCCAGCTAAAAATTAGGG + Intergenic
992878411 5:81080875-81080897 GTGTGCCCTGGGAGGAATTATGG + Intronic
994037779 5:95222316-95222338 ATGTGCCCAGGTAAAAATTAGGG + Intronic
994141098 5:96342182-96342204 ATGTGTCCTCAGAGGAATTAAGG - Intergenic
1002397915 5:178972406-178972428 ATGAGCCCCTAGAAGCATTCTGG + Intergenic
1003947997 6:11093051-11093073 AGGTGCCCCCAGAAGAATAGAGG - Intergenic
1004339184 6:14793244-14793266 AAGTGCCCAGAGATGAATGAGGG + Intergenic
1020820769 7:12964561-12964583 CTCTGCCCCTAGAAGAATTCTGG - Intergenic
1020979541 7:15050888-15050910 ATGTGCCTCGATAAGAAAGATGG - Intergenic
1023720733 7:43091251-43091273 CTGTGCCCCCAGAAGAATCCAGG + Intergenic
1034341035 7:150355345-150355367 ATGTGGCCAAAGAAGATTTATGG + Intergenic
1041466546 8:58163046-58163068 ATGTCCCCTGAGGAGAAGTAGGG + Intronic
1045115295 8:98974132-98974154 ATGAGACCCGAGCAGAAATAGGG + Intergenic
1048163229 8:132039638-132039660 ATGTGGCCTGAGAAGGAATAGGG - Intronic
1056519076 9:87383486-87383508 ATGCGCCTCCAGAAAAATTATGG - Intergenic
1057140814 9:92725841-92725863 ATTTGCCCCAAGAAGGAGTAGGG - Intronic
1057725668 9:97566300-97566322 ATGTGCCGAGTGAAGATTTAGGG - Intronic
1188303649 X:28535636-28535658 ATTTCCCCAGAAAAGAATTAGGG - Intergenic
1192069080 X:67918131-67918153 ATGTGTCCCTAGGAGGATTACGG + Intergenic
1199404865 X:147444909-147444931 ATGTGGCCAGAGAGGATTTAAGG - Intergenic