ID: 1118371827

View in Genome Browser
Species Human (GRCh38)
Location 14:65144185-65144207
Sequence CATGACAGGCTGCAGTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118371827_1118371829 16 Left 1118371827 14:65144185-65144207 CCTTTCAACTGCAGCCTGTCATG No data
Right 1118371829 14:65144224-65144246 ACTTACTGCTGTGCTCCCTCAGG No data
1118371827_1118371830 22 Left 1118371827 14:65144185-65144207 CCTTTCAACTGCAGCCTGTCATG No data
Right 1118371830 14:65144230-65144252 TGCTGTGCTCCCTCAGGCATAGG No data
1118371827_1118371831 23 Left 1118371827 14:65144185-65144207 CCTTTCAACTGCAGCCTGTCATG No data
Right 1118371831 14:65144231-65144253 GCTGTGCTCCCTCAGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118371827 Original CRISPR CATGACAGGCTGCAGTTGAA AGG (reversed) Intergenic
No off target data available for this crispr