ID: 1118372794

View in Genome Browser
Species Human (GRCh38)
Location 14:65152169-65152191
Sequence CTAAGGTTCCTCAAATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118372786_1118372794 25 Left 1118372786 14:65152121-65152143 CCACCTCCAAGGAGGGTGACTTA No data
Right 1118372794 14:65152169-65152191 CTAAGGTTCCTCAAATGCCCAGG No data
1118372789_1118372794 19 Left 1118372789 14:65152127-65152149 CCAAGGAGGGTGACTTAGGTGAG No data
Right 1118372794 14:65152169-65152191 CTAAGGTTCCTCAAATGCCCAGG No data
1118372788_1118372794 22 Left 1118372788 14:65152124-65152146 CCTCCAAGGAGGGTGACTTAGGT No data
Right 1118372794 14:65152169-65152191 CTAAGGTTCCTCAAATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118372794 Original CRISPR CTAAGGTTCCTCAAATGCCC AGG Intergenic
No off target data available for this crispr