ID: 1118375401

View in Genome Browser
Species Human (GRCh38)
Location 14:65172576-65172598
Sequence CTGTGGTTTTCCTGCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118375398_1118375401 13 Left 1118375398 14:65172540-65172562 CCTGATGTATGTGTGCTGAAGGA No data
Right 1118375401 14:65172576-65172598 CTGTGGTTTTCCTGCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118375401 Original CRISPR CTGTGGTTTTCCTGCCAAAA AGG Intergenic
No off target data available for this crispr