ID: 1118375765

View in Genome Browser
Species Human (GRCh38)
Location 14:65175741-65175763
Sequence TGGGAGGATCACTTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381320
Summary {0: 1920, 1: 16397, 2: 53809, 3: 123827, 4: 185367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118375765_1118375772 0 Left 1118375765 14:65175741-65175763 CCTGGCCTCAAGTGATCCTCCCA 0: 1920
1: 16397
2: 53809
3: 123827
4: 185367
Right 1118375772 14:65175764-65175786 TCTTGGCCTCCCAAAGTGCTGGG 0: 5583
1: 99313
2: 221046
3: 234614
4: 143836
1118375765_1118375771 -1 Left 1118375765 14:65175741-65175763 CCTGGCCTCAAGTGATCCTCCCA 0: 1920
1: 16397
2: 53809
3: 123827
4: 185367
Right 1118375771 14:65175763-65175785 ATCTTGGCCTCCCAAAGTGCTGG 0: 2089
1: 36048
2: 135265
3: 227170
4: 201712
1118375765_1118375776 18 Left 1118375765 14:65175741-65175763 CCTGGCCTCAAGTGATCCTCCCA 0: 1920
1: 16397
2: 53809
3: 123827
4: 185367
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data
1118375765_1118375777 25 Left 1118375765 14:65175741-65175763 CCTGGCCTCAAGTGATCCTCCCA 0: 1920
1: 16397
2: 53809
3: 123827
4: 185367
Right 1118375777 14:65175789-65175811 TACAGATGAGCCACGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118375765 Original CRISPR TGGGAGGATCACTTGAGGCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr