ID: 1118375766

View in Genome Browser
Species Human (GRCh38)
Location 14:65175746-65175768
Sequence CAAGATGGGAGGATCACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110296
Summary {0: 133, 1: 1489, 2: 8767, 3: 31781, 4: 68126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118375766_1118375777 20 Left 1118375766 14:65175746-65175768 CCTCAAGTGATCCTCCCATCTTG 0: 133
1: 1489
2: 8767
3: 31781
4: 68126
Right 1118375777 14:65175789-65175811 TACAGATGAGCCACGGAGATTGG No data
1118375766_1118375771 -6 Left 1118375766 14:65175746-65175768 CCTCAAGTGATCCTCCCATCTTG 0: 133
1: 1489
2: 8767
3: 31781
4: 68126
Right 1118375771 14:65175763-65175785 ATCTTGGCCTCCCAAAGTGCTGG 0: 2089
1: 36048
2: 135265
3: 227170
4: 201712
1118375766_1118375772 -5 Left 1118375766 14:65175746-65175768 CCTCAAGTGATCCTCCCATCTTG 0: 133
1: 1489
2: 8767
3: 31781
4: 68126
Right 1118375772 14:65175764-65175786 TCTTGGCCTCCCAAAGTGCTGGG 0: 5583
1: 99313
2: 221046
3: 234614
4: 143836
1118375766_1118375776 13 Left 1118375766 14:65175746-65175768 CCTCAAGTGATCCTCCCATCTTG 0: 133
1: 1489
2: 8767
3: 31781
4: 68126
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118375766 Original CRISPR CAAGATGGGAGGATCACTTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr