ID: 1118375768

View in Genome Browser
Species Human (GRCh38)
Location 14:65175757-65175779
Sequence CTTTGGGAGGCCAAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422865
Summary {0: 1654, 1: 26821, 2: 80412, 3: 156298, 4: 157680}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118375768_1118375777 9 Left 1118375768 14:65175757-65175779 CCTCCCATCTTGGCCTCCCAAAG 0: 1654
1: 26821
2: 80412
3: 156298
4: 157680
Right 1118375777 14:65175789-65175811 TACAGATGAGCCACGGAGATTGG No data
1118375768_1118375776 2 Left 1118375768 14:65175757-65175779 CCTCCCATCTTGGCCTCCCAAAG 0: 1654
1: 26821
2: 80412
3: 156298
4: 157680
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118375768 Original CRISPR CTTTGGGAGGCCAAGATGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr