ID: 1118375769

View in Genome Browser
Species Human (GRCh38)
Location 14:65175760-65175782
Sequence GCACTTTGGGAGGCCAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 629123
Summary {0: 2150, 1: 37816, 2: 142479, 3: 236649, 4: 210029}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118375769_1118375777 6 Left 1118375769 14:65175760-65175782 CCCATCTTGGCCTCCCAAAGTGC 0: 2150
1: 37816
2: 142479
3: 236649
4: 210029
Right 1118375777 14:65175789-65175811 TACAGATGAGCCACGGAGATTGG No data
1118375769_1118375776 -1 Left 1118375769 14:65175760-65175782 CCCATCTTGGCCTCCCAAAGTGC 0: 2150
1: 37816
2: 142479
3: 236649
4: 210029
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118375769 Original CRISPR GCACTTTGGGAGGCCAAGAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr