ID: 1118375776

View in Genome Browser
Species Human (GRCh38)
Location 14:65175782-65175804
Sequence CTGGGATTACAGATGAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118375769_1118375776 -1 Left 1118375769 14:65175760-65175782 CCCATCTTGGCCTCCCAAAGTGC 0: 2150
1: 37816
2: 142479
3: 236649
4: 210029
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data
1118375765_1118375776 18 Left 1118375765 14:65175741-65175763 CCTGGCCTCAAGTGATCCTCCCA 0: 1920
1: 16397
2: 53809
3: 123827
4: 185367
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data
1118375766_1118375776 13 Left 1118375766 14:65175746-65175768 CCTCAAGTGATCCTCCCATCTTG 0: 133
1: 1489
2: 8767
3: 31781
4: 68126
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data
1118375768_1118375776 2 Left 1118375768 14:65175757-65175779 CCTCCCATCTTGGCCTCCCAAAG 0: 1654
1: 26821
2: 80412
3: 156298
4: 157680
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data
1118375770_1118375776 -2 Left 1118375770 14:65175761-65175783 CCATCTTGGCCTCCCAAAGTGCT 0: 3853
1: 66063
2: 153594
3: 157369
4: 93226
Right 1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118375776 Original CRISPR CTGGGATTACAGATGAGCCA CGG Intergenic
No off target data available for this crispr