ID: 1118377712

View in Genome Browser
Species Human (GRCh38)
Location 14:65191546-65191568
Sequence TCCCATGGTTGCCAGATTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118377712_1118377725 26 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377725 14:65191595-65191617 AGGAAGGAGTTGCCAGGACCTGG No data
1118377712_1118377724 20 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377724 14:65191589-65191611 AAAAGGAGGAAGGAGTTGCCAGG No data
1118377712_1118377723 10 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG No data
1118377712_1118377716 -5 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377716 14:65191564-65191586 TGGGAGTCATCCCTACCTCAAGG No data
1118377712_1118377726 29 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377726 14:65191598-65191620 AAGGAGTTGCCAGGACCTGGAGG No data
1118377712_1118377727 30 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377727 14:65191599-65191621 AGGAGTTGCCAGGACCTGGAGGG No data
1118377712_1118377717 -4 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377717 14:65191565-65191587 GGGAGTCATCCCTACCTCAAGGG No data
1118377712_1118377721 6 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377721 14:65191575-65191597 CCTACCTCAAGGGCAAAAGGAGG No data
1118377712_1118377718 3 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377718 14:65191572-65191594 ATCCCTACCTCAAGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118377712 Original CRISPR TCCCATGGTTGCCAGATTAG GGG (reversed) Intergenic
No off target data available for this crispr