ID: 1118377714

View in Genome Browser
Species Human (GRCh38)
Location 14:65191548-65191570
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118377714_1118377725 24 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377725 14:65191595-65191617 AGGAAGGAGTTGCCAGGACCTGG No data
1118377714_1118377723 8 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG No data
1118377714_1118377724 18 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377724 14:65191589-65191611 AAAAGGAGGAAGGAGTTGCCAGG No data
1118377714_1118377721 4 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377721 14:65191575-65191597 CCTACCTCAAGGGCAAAAGGAGG No data
1118377714_1118377717 -6 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377717 14:65191565-65191587 GGGAGTCATCCCTACCTCAAGGG No data
1118377714_1118377727 28 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377727 14:65191599-65191621 AGGAGTTGCCAGGACCTGGAGGG No data
1118377714_1118377726 27 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377726 14:65191598-65191620 AAGGAGTTGCCAGGACCTGGAGG No data
1118377714_1118377718 1 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377718 14:65191572-65191594 ATCCCTACCTCAAGGGCAAAAGG No data
1118377714_1118377716 -7 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377716 14:65191564-65191586 TGGGAGTCATCCCTACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118377714 Original CRISPR ACTCCCATGGTTGCCAGATT AGG (reversed) Intergenic
No off target data available for this crispr