ID: 1118377723

View in Genome Browser
Species Human (GRCh38)
Location 14:65191579-65191601
Sequence CCTCAAGGGCAAAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118377712_1118377723 10 Left 1118377712 14:65191546-65191568 CCCCTAATCTGGCAACCATGGGA No data
Right 1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG No data
1118377713_1118377723 9 Left 1118377713 14:65191547-65191569 CCCTAATCTGGCAACCATGGGAG No data
Right 1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG No data
1118377714_1118377723 8 Left 1118377714 14:65191548-65191570 CCTAATCTGGCAACCATGGGAGT No data
Right 1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG No data
1118377715_1118377723 -5 Left 1118377715 14:65191561-65191583 CCATGGGAGTCATCCCTACCTCA No data
Right 1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118377723 Original CRISPR CCTCAAGGGCAAAAGGAGGA AGG Intergenic
No off target data available for this crispr