ID: 1118380427

View in Genome Browser
Species Human (GRCh38)
Location 14:65213544-65213566
Sequence CACAGGGAGGAGGGTATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 8, 3: 29, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118380427 Original CRISPR CACAGGGAGGAGGGTATAAT GGG Intergenic
900434291 1:2620936-2620958 CAATGGGAAGAGGGTATAATGGG - Intronic
900546010 1:3229580-3229602 CACAGGCAGGATGGCAGAATCGG + Intronic
900594405 1:3473968-3473990 CACAGGGCAGAGGGTATATGAGG + Intronic
901874838 1:12161561-12161583 CACAGGAAGGGGGCTAGAATGGG + Intergenic
902732380 1:18377876-18377898 CCCAGGGAGGACAGTATAAAGGG - Intronic
903135157 1:21304451-21304473 CACAGTGAGGAGGAGATAAGGGG - Intronic
903472401 1:23596363-23596385 CACAGGGTCTAGTGTATAATAGG + Intronic
903579566 1:24360722-24360744 TACAGGGATGAGGGTAGATTTGG - Intronic
903968329 1:27103119-27103141 CACAGGGAGAAGGGGCTGATGGG + Intronic
905012643 1:34757791-34757813 CACAGGAGGGAGGATATATTTGG - Exonic
905181320 1:36168770-36168792 ACAAGGCAGGAGGGTATAATGGG + Intronic
905694671 1:39965786-39965808 CCCAGGGAGGAAGGTCAAATGGG - Intronic
906134540 1:43487607-43487629 CAGAAGGAGGAGGGTGAAATGGG + Intergenic
912161134 1:106986639-106986661 CACAGGGAGGAGGATACCACAGG + Intergenic
913049281 1:115102703-115102725 CACAGGGAGGAGAGAAGAATCGG - Intergenic
913281079 1:117185576-117185598 AAAAGAGAGGAGGATATAATGGG - Intronic
913383347 1:118233144-118233166 CACAGGGAGGATTGTAAAAAGGG + Intergenic
913589084 1:120305366-120305388 CACACTGAGAAGGGTTTAATTGG + Intergenic
913619101 1:120593003-120593025 CACACTGAGAAGGGTTTAATTGG - Intergenic
914571106 1:148917254-148917276 CACACTGAGAAGGGTTTAATTGG + Intronic
914601725 1:149213022-149213044 CACACTGAGAAGGGTTTAATTGG - Intergenic
915366212 1:155318063-155318085 CACAGGGAGGTGGTTATATATGG + Intronic
915734448 1:158075918-158075940 CAGAGGGAGGAAGGAATAAAGGG + Intronic
917134335 1:171774725-171774747 AACAGGAAGGAGGGGAAAATAGG + Intergenic
918823245 1:189286711-189286733 CAGAGGAAGGCGGGTAGAATAGG - Intergenic
920339175 1:205264997-205265019 CACAGGGAAGAGAATAAAATGGG + Intronic
921778181 1:219127167-219127189 AACAGAGGGGAGGGTATTATTGG - Intergenic
923657481 1:235930689-235930711 CAAAGGGAGGAGGGTAAATGGGG + Intergenic
923687935 1:236166896-236166918 CTCAGGGAGGAGGCTGAAATGGG - Intronic
1064148296 10:12842447-12842469 CACAGGGAGGACGGTGTGGTTGG - Intergenic
1065245612 10:23753995-23754017 AACAGGGAGGAGGGGACATTGGG - Intronic
1065481187 10:26195471-26195493 CAATGGGAGGATAGTATAATTGG - Intronic
1066202692 10:33157466-33157488 CACAGAGTGGAGGGAAGAATAGG - Intergenic
1067896713 10:50189564-50189586 CACAGTGAGGAAGGTCTGATGGG + Exonic
1067952258 10:50752469-50752491 CACAGTGAGGAAGGTCTGATGGG - Exonic
1068761489 10:60715564-60715586 GACAGGCAGGAGGGTATATTTGG + Intronic
1070158041 10:73848357-73848379 CGCAGGGAGGAGGGTGTGATGGG + Intronic
1071537292 10:86444660-86444682 CCCAGGGAGGAGGGGAAAATAGG + Intronic
1072095208 10:92171561-92171583 CAAAGGAAGGGGGGTAGAATAGG + Intronic
1073308126 10:102519173-102519195 CAATGGCAGGAGGGTAAAATGGG + Intronic
1073541621 10:104319860-104319882 CAGAGGGAGGAGGGTATAATGGG - Intronic
1076191979 10:128489525-128489547 CCCAGGGAGGAGGGTGCACTGGG - Intergenic
1076702895 10:132283457-132283479 CACTGGGAGGAGGGTGTCATGGG + Intronic
1077937080 11:6799747-6799769 CAGAAGGAGGAGGGAAAAATGGG - Intergenic
1079891074 11:26053918-26053940 CAAAAGGAGGAGAGTATAAGAGG + Intergenic
1081249195 11:40808871-40808893 CACAGGAAGAAAGGTAGAATAGG - Intronic
1083664770 11:64268455-64268477 CACAGGGATGAGGGGATGCTGGG - Intronic
1084125924 11:67098993-67099015 CAGAGGGAGGAGGTGGTAATGGG - Intergenic
1086272021 11:85079351-85079373 CAAGAGGAGGAGGATATAATGGG + Intronic
1086272495 11:85083858-85083880 TAAGGGGAGGAAGGTATAATGGG + Intronic
1089650770 11:119911237-119911259 CAGAGGGAGGAGGGGGCAATGGG + Intergenic
1090961756 11:131563420-131563442 CCCAGGGATGATGGTAAAATAGG - Intronic
1091178653 11:133583356-133583378 CACAGGGAGGAGGTCATTTTGGG + Intergenic
1091315525 11:134611422-134611444 CCCAGGGAGGTGGGTAAACTTGG - Intergenic
1093925134 12:24902437-24902459 CACAGGGAAGCGGGACTAATTGG + Intronic
1095765845 12:45894964-45894986 CGCAGGGAGGAGGGCATTCTAGG - Intronic
1095942296 12:47735230-47735252 CAAAGGGAGGAGGGGCTCATGGG - Intronic
1096768598 12:53916081-53916103 GGCTGGGAGGAGAGTATAATGGG - Intergenic
1097053725 12:56238260-56238282 CACAGGGTGGAGGGTGCAACAGG + Exonic
1097184647 12:57190000-57190022 CACAAGGAGCACGGCATAATTGG + Intronic
1101800990 12:108021795-108021817 CACAGGGAGGGTGGTAGAAGGGG + Intergenic
1104278635 12:127353564-127353586 CACAGGGAGCAGGGGATAGCTGG - Intergenic
1104914011 12:132255179-132255201 CAAAGGGAGGAGAGTCTAAGGGG - Intronic
1105031729 12:132888662-132888684 CAAAGGGAGGACAGTATAATGGG - Intronic
1108816221 13:54294197-54294219 CAGAGGGAGCAAGTTATAATTGG + Intergenic
1108821627 13:54357738-54357760 TCCAGCGAGGAGGGTATAGTGGG - Intergenic
1109442876 13:62398049-62398071 CAAAGGAAGGAGGGTATAATGGG - Intergenic
1112452816 13:99527200-99527222 CAGAGGGTAGAGGGCATAATGGG + Intronic
1112600229 13:100847888-100847910 CACAGGGAGGCGTGAAGAATTGG + Intergenic
1115060075 14:29176868-29176890 CAAAGGGAGGCGTATATAATGGG - Intergenic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1115938306 14:38580031-38580053 CACAGGAAGGAGGGTAAATTTGG - Intergenic
1116135643 14:40919975-40919997 CACAAAGAGGAGGCTATAATTGG - Intergenic
1117621615 14:57593019-57593041 CACAGGTAGGGGGCTAAAATTGG + Intronic
1118380427 14:65213544-65213566 CACAGGGAGGAGGGTATAATGGG + Intergenic
1120909098 14:89649298-89649320 CACAGGGACGGGGCTTTAATAGG + Intergenic
1121816358 14:96932013-96932035 CACAGGGAGGAGCATACAAGTGG + Intergenic
1122278004 14:100605114-100605136 CACAGGGAGGAGGGAATCAAGGG + Intergenic
1122360843 14:101162052-101162074 CAAAGGGAGAAGAGTATAATGGG + Intergenic
1123961357 15:25404798-25404820 CATAGGGAGTAGGGGACAATAGG - Intronic
1123986009 15:25646762-25646784 CACTGGGAGAAGGGAAAAATGGG + Intergenic
1124833502 15:33173213-33173235 TACAAGGAGGAGGACATAATTGG + Intronic
1124866115 15:33492990-33493012 CAGAGGGAGGAGGGTGTAAGTGG + Intronic
1126662610 15:51047533-51047555 CACTGGGAGGAGGGAAGAAGAGG - Intergenic
1127901257 15:63342614-63342636 AAAAGGGAGGAGGGTATAATGGG + Intronic
1128440129 15:67699219-67699241 CACAGAGAGGAAAGTAGAATGGG + Intronic
1130486336 15:84400444-84400466 CTCAGGGAGGAGGGCAGAACTGG - Intergenic
1131439580 15:92448746-92448768 CACAAGGAGGAGAGTGCAATAGG + Intronic
1131767635 15:95697337-95697359 AAGAAGGTGGAGGGTATAATGGG - Intergenic
1132997914 16:2832905-2832927 CAAAGGGAGGAGGGGATTACAGG + Intronic
1137396760 16:48121488-48121510 CACTGGGAAGAGGATAGAATCGG - Intronic
1138393741 16:56688992-56689014 CAAAGGGAGGTGGGTATCACTGG - Intronic
1139966195 16:70746694-70746716 CACAGGGCGGAGGGCAGGATGGG + Intronic
1140421887 16:74826090-74826112 CACAAGGATGTGGGTATAAAGGG - Intergenic
1140740577 16:77937663-77937685 CACTGGGAGGAGTGCATACTGGG - Intronic
1141286002 16:82672629-82672651 CAGATGGAGGAGGAAATAATAGG - Intronic
1142056072 16:87996724-87996746 CACAGGGAGGAGGGAAGGACGGG - Intronic
1144150347 17:12437076-12437098 CAAAGGGATGAGGGTAGATTAGG - Intergenic
1146829401 17:36055137-36055159 TATAGTGAGGAGGGAATAATGGG + Intergenic
1147905839 17:43822603-43822625 CACGGGGAGGAGGGTGGAGTGGG - Intronic
1148178617 17:45587205-45587227 CAGAGGGGGGAAGGTATGATCGG - Intergenic
1148270537 17:46259250-46259272 CAGAGGGGGGAAGGTATGATCGG + Intergenic
1149666398 17:58367704-58367726 CAGAGGGTGGAGGGGATAGTGGG + Intronic
1153642745 18:7170334-7170356 CATAGGGAGGAGAGGATATTAGG - Intergenic
1155238094 18:23841576-23841598 AAAAGGGACAAGGGTATAATAGG + Intronic
1157676010 18:49569188-49569210 GACAGGGTGGAGGGTATGACTGG - Intronic
1159257422 18:65965205-65965227 CAGTGGGAAGAGGATATAATTGG - Intergenic
1159677701 18:71306226-71306248 CCAAGGGAGGAGAGTATAATGGG + Intergenic
1160543737 18:79639294-79639316 CAGAGGGAGGAGGGTAGAATGGG - Intergenic
1160789528 19:917182-917204 CACCGGGAGGAGGGAATAGGGGG + Intergenic
1162548301 19:11344394-11344416 CACAGACAGGAGGGGATTATGGG - Intronic
1162897799 19:13775859-13775881 CAGGGGGAGGAGGGCAGAATGGG - Intronic
1163493813 19:17633004-17633026 CTCAGGCATGAGGGTATTATAGG + Intronic
1164907831 19:31981977-31981999 CCCTGGGAGGAGGGCATCATGGG - Intergenic
1164976440 19:32576175-32576197 CAGAGGGAAGAGGGTAAAAGTGG - Intergenic
1165348192 19:35262066-35262088 CACAGTGAGCAGGGTTTAGTGGG - Intronic
1165763097 19:38334025-38334047 GACAGGGAGGAGAGTATGAGGGG + Intergenic
1166088385 19:40492106-40492128 CCCAGGGAGGAGGATAGAGTTGG + Intronic
1166712271 19:44945060-44945082 CACAGAGAGGAGCGGATAAATGG + Intronic
1167249902 19:48394163-48394185 CACAGAGTGGGGGGTCTAATGGG - Intergenic
1168557901 19:57358753-57358775 CCCAGTGAGGAGGGCATAGTTGG + Exonic
926799774 2:16649864-16649886 CCCTGGGAGGAGGTTACAATTGG + Intronic
929413448 2:41723115-41723137 TAGAGGGAGGAGTGTAGAATTGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931831450 2:66055911-66055933 CACATGGAAGAAGGGATAATGGG - Intergenic
934039748 2:88118012-88118034 CACAGGGAGATGTGTATAAATGG - Intergenic
935889201 2:107657646-107657668 CCCAGGGAGGAGGGAATGAATGG - Intergenic
936090109 2:109496129-109496151 CACAGGGAGGATGGAAAAAAGGG - Intronic
936481195 2:112886366-112886388 AAAAGGGAGAAGGGTATACTGGG - Intergenic
937306602 2:120875403-120875425 CACTTGGAGGAGGGTATATGGGG + Intronic
937745277 2:125404806-125404828 AGCAGGGAGCAGGGTATGATGGG - Intergenic
938263451 2:129910833-129910855 CAAAGGAAGGAGGGTATATGTGG - Intergenic
938662206 2:133498583-133498605 GACAGGGAGAAGGGAAAAATGGG + Intronic
938924191 2:136024273-136024295 CAGAGGGTAGAGGGAATAATCGG + Intergenic
939044013 2:137228415-137228437 GACAGGGAGGATGGTAAATTTGG + Intronic
941833073 2:169983673-169983695 TACAGGGAGGAGTGGAGAATTGG + Intronic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
942147589 2:173041953-173041975 CACAGGGAGGAGGGGAGATCAGG - Intronic
943069701 2:183125976-183125998 GACAGGAAGGAGGGCACAATGGG - Intronic
943657247 2:190522602-190522624 AAAAGGGAGGAGGGCATAATGGG - Intronic
944151041 2:196559207-196559229 CTCAGGTGGGAGGGTCTAATGGG - Intronic
944186952 2:196959534-196959556 CACAGGGAGGTGGGAAAAAATGG + Intergenic
945795838 2:214362584-214362606 CACAGTGAGGAGGAAACAATTGG - Intronic
945889728 2:215416779-215416801 CACAAGGAGGAGGATAAAAATGG + Intronic
946560445 2:220906436-220906458 AACAGTCAGGAGGGTATGATGGG + Intergenic
947079322 2:226378358-226378380 CACAGGGAGTAGGTTGTAAAGGG - Intergenic
948315641 2:237026573-237026595 CACCGGGAGGAGGGGATGACTGG + Intergenic
1168925985 20:1579334-1579356 CACAGAGTGGAGGCCATAATTGG - Intronic
1168979965 20:1995916-1995938 CATAAGGAGGAGGGTAGAAGGGG + Intergenic
1170779517 20:19411655-19411677 CACTTGGAGGAGGGTCTCATTGG + Intronic
1171185812 20:23123314-23123336 CACAGGGAGGAATGTAGAATGGG + Intergenic
1171494435 20:25545578-25545600 TAAAGGGAGGAGGGCATAATGGG - Intronic
1173109955 20:40177390-40177412 CACAGGGATGAGGGTGAAGTGGG - Intergenic
1174306198 20:49615908-49615930 CACAGGGAGGAGGGCAGATTTGG - Intergenic
1174440353 20:50546758-50546780 CCCAGGGAGAAAGGTATCATAGG - Intronic
1176996373 21:15560011-15560033 CACAGGGGAGAGGGGAGAATGGG + Intergenic
1177048824 21:16205612-16205634 GACAGGAAGGAGGGAATGATGGG + Intergenic
1178213708 21:30569005-30569027 CACAGGGTGGGGGTCATAATGGG - Intergenic
1179129731 21:38624243-38624265 CCCAGGGAGGAGAGTTTAAGTGG - Intronic
1180538411 22:16418254-16418276 CAGGGGGAGGAGGGTAGAACTGG + Intergenic
1184946813 22:47809535-47809557 CCCAGGAAGGAGCGTAAAATTGG + Intergenic
949130690 3:496874-496896 CATAGGCAGGGTGGTATAATAGG - Intergenic
949151053 3:767358-767380 CACAAGGAGGTGGGGGTAATCGG + Intergenic
949965368 3:9351534-9351556 CTCAGGGAGGAGGGAATATGGGG - Intronic
950119349 3:10471284-10471306 CACAGGGAAGAGGGTGGGATTGG - Intronic
951131556 3:19052106-19052128 GTCAGGGATGAGGGTATAGTTGG - Intergenic
952849315 3:37714540-37714562 CACATGGAGGATGGTCTCATAGG - Intronic
954578701 3:51691356-51691378 CACAGGGAGGAGGGCACTTTTGG + Intronic
955800271 3:62679299-62679321 CACACTGAGGAAGGTATTATAGG + Intronic
956147567 3:66206481-66206503 CACAGGGATGTCTGTATAATTGG + Intronic
956418037 3:69053476-69053498 CACAGCAGGGAGGGTGTAATAGG - Intergenic
957394024 3:79617062-79617084 CCCTGGGATGAGGGTATGATAGG + Intronic
959677270 3:109050418-109050440 CACATGGAGAAGGGGATAAGGGG + Intronic
962303973 3:134269647-134269669 CATAGGGAGAAGGGTCTTATTGG + Intergenic
963777968 3:149458840-149458862 GACTGGGAGGAGGCTAGAATGGG + Intergenic
964682305 3:159355694-159355716 CACAGGGAGGGGGTTTTGATGGG - Intronic
972293429 4:37713642-37713664 CAAAGGGAGGTGAGTATAATGGG + Intergenic
978839073 4:113187934-113187956 CACAGTGATGAGGATGTAATAGG - Intronic
986725122 5:10589897-10589919 CACAGGCAGCATGGTATAAAAGG - Intronic
987231175 5:15895396-15895418 CACATGGAACAGGGCATAATTGG + Intronic
988636755 5:32992993-32993015 CACAGGCAGGAGTTTTTAATTGG - Intergenic
989153813 5:38325118-38325140 GGCAGGGAAGAGGGTATAGTGGG + Intronic
990405989 5:55491374-55491396 CACAAGGAGGAGAGCAAAATTGG + Intronic
990640813 5:57781621-57781643 CACAGGGAGAAGATGATAATAGG - Intergenic
991618341 5:68519299-68519321 AGGAGGGAGGAGGGTATGATAGG - Intergenic
992459784 5:76949797-76949819 GATTGGGAGGAGGGTAAAATGGG + Intergenic
992554858 5:77893172-77893194 CACTTGGAGGAGGGCAGAATAGG - Intergenic
993454563 5:88112767-88112789 CACAGTGAGGAGGATGAAATAGG + Intergenic
994294306 5:98070980-98071002 GACCGGGAGGTGGGAATAATTGG - Intergenic
995313491 5:110739423-110739445 CACAGGGATGAGGGGTTACTGGG + Intronic
995396184 5:111689497-111689519 CACAAGGGGAAGAGTATAATAGG - Intronic
998266424 5:140670995-140671017 CAGAGGGGGGAAGGTATGATCGG + Exonic
1001091000 5:168740915-168740937 CCCAGGAAGGAGAGTATAACTGG + Intronic
1001477979 5:172064554-172064576 TGCATGGAGGAGGGGATAATGGG + Intronic
1004944692 6:20598021-20598043 GACAGAGAGGAGGGAATAACAGG - Intronic
1005125552 6:22442875-22442897 CACAGGGAGGGGTGAAGAATTGG - Intergenic
1005820679 6:29596094-29596116 CAGAGGAAGGAGGGTATCATTGG - Intronic
1006268060 6:32941777-32941799 CCCAGGGAACAGGGTATAGTAGG - Intronic
1006306875 6:33227812-33227834 CACAGGGTGGAGGAGAGAATAGG - Intergenic
1006765020 6:36497432-36497454 CACAGGGTGGAAGGTATCACTGG - Intronic
1006938197 6:37733032-37733054 CAAAGGGAGGAAGGTATTAGTGG - Intergenic
1007000817 6:38310775-38310797 CAAAGCTAGAAGGGTATAATTGG - Intronic
1007835682 6:44671869-44671891 CAAAGGGAGCAGGGTATGGTGGG - Intergenic
1011902076 6:92311525-92311547 CACAGGGAGGAATGAATAATTGG - Intergenic
1014344843 6:120255151-120255173 CACAAAGAGGAGGGTATGAAAGG - Intergenic
1015241742 6:131031935-131031957 CAAAGTGAAGAGGGTATAAAAGG + Intronic
1015459556 6:133473657-133473679 CACAGGTAGGAGGATATAAAAGG - Intronic
1016521486 6:144951557-144951579 CAAAGGGAAGAGGGTATAACAGG - Intergenic
1016607419 6:145947475-145947497 CCGAGGTAGGAGGGTATAGTAGG - Exonic
1016991785 6:149935193-149935215 CACAGGGAGGAGGGAATATCTGG - Intergenic
1017007951 6:150041427-150041449 CACAGGGAGGAGGGAATGTCAGG + Intergenic
1019497610 7:1347764-1347786 CACAGTGAGGACTGGATAATCGG + Intergenic
1019950068 7:4364965-4364987 CAGTGGGAGGAGGGTATAATGGG - Intergenic
1020801879 7:12742323-12742345 GGCTGGGAGGAGGGTAAAATGGG - Intergenic
1022301523 7:29106641-29106663 AACAGGGAAGAGGGTAGAATTGG + Intronic
1022368592 7:29749581-29749603 CACAAGGAGGTGGGGATCATGGG - Intergenic
1023386869 7:39667323-39667345 CACAGGGAGTTGGGGATAAGAGG - Intronic
1023492010 7:40752749-40752771 CACAGGGAGAAGTAAATAATTGG + Intronic
1023658591 7:42450833-42450855 CACTAGGAGGAGGAGATAATGGG - Intergenic
1024305477 7:47925626-47925648 CAATGGGAGGAGGGTATCGTGGG - Intronic
1024504910 7:50154221-50154243 CACAGGGGGAAGGGGAAAATGGG - Intronic
1026409922 7:70109748-70109770 GAAAGGGAGGAGGTTATTATGGG + Intronic
1027869850 7:83693488-83693510 CAAAGGAAGGAGGGTATAATGGG + Intergenic
1028266796 7:88735204-88735226 CACTGAAAGGCGGGTATAATGGG + Intergenic
1028728535 7:94117547-94117569 CACAGGGAAAAGTGAATAATTGG + Intergenic
1031502820 7:122542209-122542231 CACAGTGATGAGGCTATAATTGG + Intronic
1031609565 7:123809032-123809054 GACAAGAAGGAGGATATAATTGG + Intergenic
1033243183 7:139697814-139697836 GGCTGGGAGGAGGGGATAATAGG - Intronic
1033275609 7:139969624-139969646 CCCAGGGAGGAGGGCATGGTTGG + Intronic
1034777352 7:153840997-153841019 CACAGGAAGGAGCTTTTAATTGG - Intergenic
1039983707 8:42429931-42429953 CACAGGGAGGAGGAGACAGTGGG - Intronic
1040758506 8:50809188-50809210 CACAGGGAGGAGTGTGCACTGGG + Intergenic
1041015241 8:53586502-53586524 GATAGGGAGGAGGCTATATTAGG - Intergenic
1042207172 8:66340969-66340991 CAGAGGGAGGAAGGTATATTGGG - Intergenic
1044205548 8:89488815-89488837 CACTAGGAGGTGGGGATAATTGG + Intergenic
1044396576 8:91720416-91720438 CAAAGGGAGGAGGGTAGAATGGG + Intergenic
1044828272 8:96219785-96219807 CACAGGAAGGAATGGATAATTGG - Intergenic
1047359618 8:124156163-124156185 TAGAGGGAGGAGGGTAGGATGGG - Intergenic
1049128625 8:140815411-140815433 CAGAGGGTGGAGGGTAAAAGTGG + Intronic
1052345371 9:27404086-27404108 CAGATGGAGGAAAGTATAATAGG - Intronic
1052386554 9:27830005-27830027 CACAGGGAGAAGGGCACACTGGG - Intergenic
1056282674 9:85057173-85057195 CACAGGGAGGTGGGCAGCATGGG + Intergenic
1056436004 9:86576708-86576730 CACAGGCAGGAGGGGACAATGGG - Intergenic
1059326514 9:113507196-113507218 CACAGGGCAGAGAGGATAATGGG - Intronic
1059909262 9:119024223-119024245 CGCAGGGAGGAGTGTGAAATGGG + Intergenic
1060749364 9:126158849-126158871 GCCAGGCAGGAGGGTACAATAGG - Intergenic
1061724942 9:132577194-132577216 CACAGGATGGAGGGTATGCTAGG + Intergenic
1062491438 9:136807045-136807067 AACCGGGAGGAGGATATGATCGG + Exonic
1185834963 X:3337071-3337093 CACAGGAAGGAGAGTAGAAGGGG + Intronic
1187295647 X:17997756-17997778 CACAGGTAGGAGGATTTAATAGG - Intergenic
1188215849 X:27476094-27476116 GATAGGGAGGCGGGTATAAAGGG + Intergenic
1189184193 X:39038078-39038100 GACAGGGAAGAGATTATAATGGG - Intergenic
1190133667 X:47774260-47774282 CACAGGGAGGAGGGAAAAATTGG - Intergenic
1190360311 X:49643142-49643164 AAAAGGGAGGAGGGCATAATGGG - Intergenic
1192484797 X:71515740-71515762 CACCGGGATGAGGGAATATTGGG - Intronic
1193758061 X:85432952-85432974 CACAGGGTGGAAGGTTCAATGGG - Intergenic
1195887519 X:109655565-109655587 CACAGGGTGGGGGGAATTATGGG + Intronic
1198607388 X:138356493-138356515 CCCAGGGAAGAAGGAATAATAGG + Intergenic
1198684826 X:139216866-139216888 CACAGGGAGGAGTGAAGAACTGG - Intronic
1199159226 X:144587611-144587633 CACAGGGAGCAGGGGGTAACAGG + Intergenic