ID: 1118381048

View in Genome Browser
Species Human (GRCh38)
Location 14:65217694-65217716
Sequence GCCCTTCAGGTTCTAGGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118381048_1118381062 20 Left 1118381048 14:65217694-65217716 CCCTTACCTAGAACCTGAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1118381062 14:65217737-65217759 CCCAGTGAGGAGGTGAACAAGGG 0: 1
1: 0
2: 1
3: 24
4: 212
1118381048_1118381056 7 Left 1118381048 14:65217694-65217716 CCCTTACCTAGAACCTGAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1118381056 14:65217724-65217746 GGAGGCCCAGGAGCCCAGTGAGG 0: 1
1: 0
2: 6
3: 100
4: 710
1118381048_1118381060 19 Left 1118381048 14:65217694-65217716 CCCTTACCTAGAACCTGAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1118381060 14:65217736-65217758 GCCCAGTGAGGAGGTGAACAAGG 0: 1
1: 0
2: 2
3: 34
4: 300
1118381048_1118381055 -5 Left 1118381048 14:65217694-65217716 CCCTTACCTAGAACCTGAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1118381055 14:65217712-65217734 AGGGCAGGAGTTGGAGGCCCAGG 0: 1
1: 0
2: 6
3: 131
4: 981
1118381048_1118381057 10 Left 1118381048 14:65217694-65217716 CCCTTACCTAGAACCTGAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1118381057 14:65217727-65217749 GGCCCAGGAGCCCAGTGAGGAGG 0: 1
1: 0
2: 4
3: 117
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118381048 Original CRISPR GCCCTTCAGGTTCTAGGTAA GGG (reversed) Intergenic
900467210 1:2831601-2831623 GCCCCTCGGGTTCTAGGTCCAGG - Intergenic
905455688 1:38086464-38086486 GTCCTTCAGGTTTTAGGCACTGG + Intergenic
907825317 1:58011169-58011191 GCCCCTCAGGGGCTAGGAAAAGG + Intronic
910125030 1:83831180-83831202 GCCTATCATGTTCTAGGTGAAGG - Intergenic
911838452 1:102651091-102651113 ACCATTCAGGATGTAGGTAAAGG - Intergenic
911870375 1:103089765-103089787 CCTCTTCAAGTTCTTGGTAAAGG - Intronic
913167651 1:116203390-116203412 GCCTGTCTGGTTCTTGGTAATGG - Intergenic
920221830 1:204409989-204410011 GCCCTTCAGGGTCTTGTTCAAGG + Exonic
1074937143 10:118192631-118192653 GCCCTCCAGGCTCCAGGGAAGGG - Intergenic
1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG + Intergenic
1077918174 11:6624454-6624476 ACCCTTCAGGATCTAGGAAATGG + Intronic
1080559590 11:33450791-33450813 GCCCTTCTGGTTCTTTGTGAAGG - Intergenic
1086526265 11:87729862-87729884 CCCATTCAGATTCAAGGTAAGGG - Intergenic
1088857644 11:113770880-113770902 TCCCTGCAGGTTCTAGATGAAGG + Intronic
1089109972 11:116047771-116047793 GTCATTCAGCTTATAGGTAACGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1093163337 12:15775649-15775671 AAGCATCAGGTTCTAGGTAAGGG - Intronic
1095352468 12:41230202-41230224 GCTCTTTAGGTTCTGGGTAAGGG + Intronic
1096485727 12:51979696-51979718 GACCTTTATCTTCTAGGTAAGGG + Intronic
1097776386 12:63651772-63651794 GTCCTTCTGGTTCTTTGTAAAGG - Intronic
1101079586 12:101169613-101169635 GCCTTTAAGTTTCTAGGTCAAGG + Intronic
1101287514 12:103330482-103330504 CCACTTCAGGTTATAGCTAATGG - Intronic
1103209697 12:119157280-119157302 GCAGTTCAGGTTCAAGATAACGG + Exonic
1103862490 12:124025960-124025982 GCCCTTCAGGGCCTTGGTTAGGG + Intronic
1105425414 13:20290732-20290754 GCCCTTCAGTTTCTGTGAAATGG - Intergenic
1106684723 13:32046163-32046185 GCTCTTCAGGCTCTGGGAAAAGG + Intronic
1107151794 13:37120105-37120127 ACCCTTCAGGTTTTAGCTCAAGG - Intergenic
1107306929 13:39032180-39032202 GCCCTCCAGATTCAAGTTAAAGG - Intronic
1107735207 13:43391914-43391936 GCCCTGCAGGTCCTGGGAAAGGG - Intronic
1112008462 13:95274329-95274351 GCCCTTCTGGTTCTAAGAACTGG - Intronic
1116425035 14:44780484-44780506 GCCCTTCCTGTTCTAATTAAAGG + Intergenic
1118381048 14:65217694-65217716 GCCCTTCAGGTTCTAGGTAAGGG - Intergenic
1118385639 14:65253498-65253520 GCCTTTCAGGTTATAAGAAAGGG + Intergenic
1122743888 14:103887017-103887039 TCTTTTCCGGTTCTAGGTAAAGG - Intergenic
1130828225 15:87571711-87571733 GCACATCAGCTTCAAGGTAATGG + Intergenic
1131443744 15:92478199-92478221 TCCATGCAGGTTTTAGGTAAAGG - Intronic
1136587751 16:31198582-31198604 GCCCTTCAGGTGTTAGGGGAAGG + Intergenic
1138173314 16:54873442-54873464 TCCCCTCAGGTTCTAGGGTATGG - Intergenic
1139587982 16:67916603-67916625 GCCCTCTGGGTTCTGGGTAATGG + Intronic
1143972816 17:10807822-10807844 GCCCTTTAGGATCCAGGTCATGG - Intergenic
1145723484 17:27093998-27094020 GCTGTTCAATTTCTAGGTAAGGG + Intergenic
1145728368 17:27154340-27154362 GCACTCCAGGTTGTAGGTAGTGG - Intergenic
1152657656 17:81527450-81527472 GCCCCTCAGGCTCTGGGGAAGGG + Intergenic
1159211835 18:65333197-65333219 TCCATTCAGATTCTAGGGAAGGG - Intergenic
1166089957 19:40502381-40502403 CCCCTTCAGGTTCCAGGAGAAGG + Exonic
1166262106 19:41647509-41647531 GCCCTTGAGGTTCCAGCTACTGG - Intronic
925235997 2:2277695-2277717 GCCCTTCAGGTGTTATGTAAAGG + Intronic
928574044 2:32636825-32636847 ATCCTTCAGGTTCTAGCTCAAGG - Intronic
932766460 2:74473697-74473719 GACCTTCAGGTTCCAGGCTATGG + Intronic
933288523 2:80410618-80410640 GCCTTTCAGCTTGTAGGCAAGGG + Intronic
937206027 2:120237739-120237761 GCCCTTCAAGTTCCTGGGAAGGG + Intergenic
937621601 2:123994300-123994322 GGCCTTCAGGGTCTAGATAAAGG + Intergenic
942543451 2:177038325-177038347 ACCATACAGGTTCTAGGGAAGGG - Intergenic
943269330 2:185777420-185777442 GCACTTCAGGTCTTAGGAAAGGG - Intronic
948099313 2:235360726-235360748 TCCCTTCAGGTTTGAGGAAATGG - Intergenic
1173443887 20:43100537-43100559 ATCCTTCAGGTTCTATGTCAAGG - Intronic
1173860740 20:46281773-46281795 GACCTTCAGATTCAAGGGAAAGG + Intronic
1173978529 20:47205523-47205545 CCCCTTCAGGTTCTACTGAACGG + Intergenic
1180179651 21:46112213-46112235 GCCCTGCAGGTTCTTGATGAAGG - Exonic
1183698255 22:39435450-39435472 GCCCTTCAGGGGCTGGGTGAGGG - Intronic
963458725 3:145578921-145578943 GCCATGCAGGTTCTTGGGAAAGG + Intergenic
975280306 4:72554420-72554442 GCCGTTCAGGTTATAGTTTAAGG - Intronic
985767671 5:1788368-1788390 GCCCTCCAGGACCTGGGTAATGG - Intergenic
1002638276 5:180618728-180618750 GCCCGTCAGGCACTAGGAAAAGG + Intronic
1008813664 6:55536724-55536746 GCCATTCAGGTTATAGGTGTGGG + Intronic
1012449194 6:99337190-99337212 ACCATTCACGATCTAGGTAAAGG + Intronic
1013630905 6:111984985-111985007 GCCCTTTAACTTCCAGGTAATGG - Intergenic
1013716623 6:112969877-112969899 GCCATTCAGGATATAGGCAAGGG + Intergenic
1022935294 7:35169369-35169391 GTCCTTCTGGTTCTTTGTAAAGG - Intergenic
1029831248 7:103262145-103262167 GTCCTTCTGGTTCTTTGTAAAGG - Intergenic
1030073722 7:105719317-105719339 GCCCTACAGGGTCTAGTTCAAGG + Intronic
1033291467 7:140087219-140087241 ACTCTTCAGGTACTAGATAAAGG - Exonic
1035899243 8:3439940-3439962 GCCCTCCTGGTTTTTGGTAAAGG - Intronic
1042242266 8:66676027-66676049 ACCCTTCAGGTTCTAAATAAAGG - Intronic
1044640264 8:94372694-94372716 GCCCCACAGGTTTTAGGAAAGGG - Intronic
1049013959 8:139906638-139906660 ACCCTGCAGGTTCTTGGTGACGG + Intronic
1049244460 8:141554595-141554617 GACCTCCAGGTTCCAGGGAAGGG + Intergenic
1049499269 8:142952793-142952815 GCCCTTCCACTTCTAGGCAATGG - Intergenic
1049536468 8:143184674-143184696 GCCCTTCAGGATCTAGGTTTGGG + Intergenic
1049981438 9:907506-907528 CCCTTTCAGGTTTTAGGAAAAGG + Intronic
1051630195 9:19133807-19133829 GCTCTTCATGTTTTACGTAAAGG + Intronic
1061697703 9:132389672-132389694 GCCCTTCATGTGCAAGGTAGGGG + Intronic
1061884775 9:133585969-133585991 GCCCTTGGGCTTCCAGGTAATGG - Intronic
1187299846 X:18037521-18037543 CCCCTTCTGGTTATAGGGAAGGG + Intergenic
1189192262 X:39120838-39120860 GCCCTCCAGGTTCCAGGCAGTGG - Intergenic
1189427734 X:40916521-40916543 CCCTATCAGGTTATAGGTAAGGG - Intergenic
1189859991 X:45262180-45262202 GCCCACCAGGTTCAAGGCAAAGG - Intergenic
1192159721 X:68775432-68775454 GCCCGTCAGCTGCTAGGCAATGG - Intergenic
1195557492 X:106243642-106243664 GGCTTTCAGGTTATAGGGAAAGG + Intergenic
1198963016 X:142202806-142202828 GCAGTTTAGGTTCTAGGTAGTGG - Exonic