ID: 1118381226

View in Genome Browser
Species Human (GRCh38)
Location 14:65219196-65219218
Sequence AAATAGAGCCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118381226_1118381229 7 Left 1118381226 14:65219196-65219218 CCTTCCTCCTTCTGGCTCTATTT No data
Right 1118381229 14:65219226-65219248 TTATTTTTCATTTTTGAGACAGG No data
1118381226_1118381231 27 Left 1118381226 14:65219196-65219218 CCTTCCTCCTTCTGGCTCTATTT No data
Right 1118381231 14:65219246-65219268 AGGGTCTTGCTCTGTCGCCCAGG 0: 726
1: 15599
2: 65036
3: 151769
4: 196617
1118381226_1118381230 8 Left 1118381226 14:65219196-65219218 CCTTCCTCCTTCTGGCTCTATTT No data
Right 1118381230 14:65219227-65219249 TATTTTTCATTTTTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118381226 Original CRISPR AAATAGAGCCAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr