ID: 1118381573

View in Genome Browser
Species Human (GRCh38)
Location 14:65221791-65221813
Sequence CTAGGGAAGAAGCTCCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118381565_1118381573 27 Left 1118381565 14:65221741-65221763 CCTCTTTCAGCCAACACGCTGCA No data
Right 1118381573 14:65221791-65221813 CTAGGGAAGAAGCTCCATGAGGG No data
1118381566_1118381573 17 Left 1118381566 14:65221751-65221773 CCAACACGCTGCACATTTTATTT No data
Right 1118381573 14:65221791-65221813 CTAGGGAAGAAGCTCCATGAGGG No data
1118381569_1118381573 -10 Left 1118381569 14:65221778-65221800 CCTATCTCCTCCACTAGGGAAGA No data
Right 1118381573 14:65221791-65221813 CTAGGGAAGAAGCTCCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118381573 Original CRISPR CTAGGGAAGAAGCTCCATGA GGG Intergenic