ID: 1118383677

View in Genome Browser
Species Human (GRCh38)
Location 14:65238103-65238125
Sequence ATCCATATAGGTCACCGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118383677_1118383682 5 Left 1118383677 14:65238103-65238125 CCCACACGGTGACCTATATGGAT No data
Right 1118383682 14:65238131-65238153 GAGCGGGATCTCTTATCTTCTGG No data
1118383677_1118383683 18 Left 1118383677 14:65238103-65238125 CCCACACGGTGACCTATATGGAT No data
Right 1118383683 14:65238144-65238166 TATCTTCTGGCCTCCCTTGTAGG No data
1118383677_1118383686 25 Left 1118383677 14:65238103-65238125 CCCACACGGTGACCTATATGGAT No data
Right 1118383686 14:65238151-65238173 TGGCCTCCCTTGTAGGGAGGAGG No data
1118383677_1118383684 19 Left 1118383677 14:65238103-65238125 CCCACACGGTGACCTATATGGAT No data
Right 1118383684 14:65238145-65238167 ATCTTCTGGCCTCCCTTGTAGGG No data
1118383677_1118383685 22 Left 1118383677 14:65238103-65238125 CCCACACGGTGACCTATATGGAT No data
Right 1118383685 14:65238148-65238170 TTCTGGCCTCCCTTGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118383677 Original CRISPR ATCCATATAGGTCACCGTGT GGG (reversed) Intergenic
No off target data available for this crispr