ID: 1118383685

View in Genome Browser
Species Human (GRCh38)
Location 14:65238148-65238170
Sequence TTCTGGCCTCCCTTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118383677_1118383685 22 Left 1118383677 14:65238103-65238125 CCCACACGGTGACCTATATGGAT No data
Right 1118383685 14:65238148-65238170 TTCTGGCCTCCCTTGTAGGGAGG No data
1118383678_1118383685 21 Left 1118383678 14:65238104-65238126 CCACACGGTGACCTATATGGATT No data
Right 1118383685 14:65238148-65238170 TTCTGGCCTCCCTTGTAGGGAGG No data
1118383680_1118383685 10 Left 1118383680 14:65238115-65238137 CCTATATGGATTACATGAGCGGG No data
Right 1118383685 14:65238148-65238170 TTCTGGCCTCCCTTGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118383685 Original CRISPR TTCTGGCCTCCCTTGTAGGG AGG Intergenic
No off target data available for this crispr