ID: 1118383691

View in Genome Browser
Species Human (GRCh38)
Location 14:65238181-65238203
Sequence ACCTGCGGGAAGGGAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118383691_1118383703 18 Left 1118383691 14:65238181-65238203 CCCCACACTCCCTTCCCGCAGGT No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data
1118383691_1118383702 15 Left 1118383691 14:65238181-65238203 CCCCACACTCCCTTCCCGCAGGT No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383691_1118383698 -10 Left 1118383691 14:65238181-65238203 CCCCACACTCCCTTCCCGCAGGT No data
Right 1118383698 14:65238194-65238216 TCCCGCAGGTGGCAGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118383691 Original CRISPR ACCTGCGGGAAGGGAGTGTG GGG (reversed) Intergenic
No off target data available for this crispr