ID: 1118383699

View in Genome Browser
Species Human (GRCh38)
Location 14:65238195-65238217
Sequence GCCAGCCTGCTGCCACCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118383699_1118383702 1 Left 1118383699 14:65238195-65238217 CCCGCAGGTGGCAGCAGGCTGGC No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383699_1118383703 4 Left 1118383699 14:65238195-65238217 CCCGCAGGTGGCAGCAGGCTGGC No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118383699 Original CRISPR GCCAGCCTGCTGCCACCTGC GGG (reversed) Intergenic
No off target data available for this crispr