ID: 1118383702

View in Genome Browser
Species Human (GRCh38)
Location 14:65238219-65238241
Sequence ACAGAACACCCCTTGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118383700_1118383702 0 Left 1118383700 14:65238196-65238218 CCGCAGGTGGCAGCAGGCTGGCC No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383695_1118383702 6 Left 1118383695 14:65238190-65238212 CCCTTCCCGCAGGTGGCAGCAGG No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383693_1118383702 13 Left 1118383693 14:65238183-65238205 CCACACTCCCTTCCCGCAGGTGG No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383692_1118383702 14 Left 1118383692 14:65238182-65238204 CCCACACTCCCTTCCCGCAGGTG No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383691_1118383702 15 Left 1118383691 14:65238181-65238203 CCCCACACTCCCTTCCCGCAGGT No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383697_1118383702 5 Left 1118383697 14:65238191-65238213 CCTTCCCGCAGGTGGCAGCAGGC No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data
1118383699_1118383702 1 Left 1118383699 14:65238195-65238217 CCCGCAGGTGGCAGCAGGCTGGC No data
Right 1118383702 14:65238219-65238241 ACAGAACACCCCTTGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118383702 Original CRISPR ACAGAACACCCCTTGACTGA AGG Intergenic
No off target data available for this crispr