ID: 1118383703

View in Genome Browser
Species Human (GRCh38)
Location 14:65238222-65238244
Sequence GAACACCCCTTGACTGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118383700_1118383703 3 Left 1118383700 14:65238196-65238218 CCGCAGGTGGCAGCAGGCTGGCC No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data
1118383699_1118383703 4 Left 1118383699 14:65238195-65238217 CCCGCAGGTGGCAGCAGGCTGGC No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data
1118383695_1118383703 9 Left 1118383695 14:65238190-65238212 CCCTTCCCGCAGGTGGCAGCAGG No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data
1118383697_1118383703 8 Left 1118383697 14:65238191-65238213 CCTTCCCGCAGGTGGCAGCAGGC No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data
1118383692_1118383703 17 Left 1118383692 14:65238182-65238204 CCCACACTCCCTTCCCGCAGGTG No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data
1118383693_1118383703 16 Left 1118383693 14:65238183-65238205 CCACACTCCCTTCCCGCAGGTGG No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data
1118383691_1118383703 18 Left 1118383691 14:65238181-65238203 CCCCACACTCCCTTCCCGCAGGT No data
Right 1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118383703 Original CRISPR GAACACCCCTTGACTGAAGG CGG Intergenic
No off target data available for this crispr