ID: 1118384304

View in Genome Browser
Species Human (GRCh38)
Location 14:65243069-65243091
Sequence GAGCTGAGCCTGATGTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118384301_1118384304 9 Left 1118384301 14:65243037-65243059 CCTTAATGGAAAGTGCTCTAGAG No data
Right 1118384304 14:65243069-65243091 GAGCTGAGCCTGATGTAAATAGG No data
1118384300_1118384304 22 Left 1118384300 14:65243024-65243046 CCACAGACGACAGCCTTAATGGA No data
Right 1118384304 14:65243069-65243091 GAGCTGAGCCTGATGTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118384304 Original CRISPR GAGCTGAGCCTGATGTAAAT AGG Intergenic
No off target data available for this crispr