ID: 1118385501

View in Genome Browser
Species Human (GRCh38)
Location 14:65252534-65252556
Sequence GACAGCTCTTGGTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118385501_1118385505 13 Left 1118385501 14:65252534-65252556 CCAGTAGCAGACCAAGAGCTGTC No data
Right 1118385505 14:65252570-65252592 AGTTATTTGTGAATGATGGCAGG No data
1118385501_1118385504 9 Left 1118385501 14:65252534-65252556 CCAGTAGCAGACCAAGAGCTGTC No data
Right 1118385504 14:65252566-65252588 GTGTAGTTATTTGTGAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118385501 Original CRISPR GACAGCTCTTGGTCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr