ID: 1118386761

View in Genome Browser
Species Human (GRCh38)
Location 14:65262144-65262166
Sequence AGATTAGTGCTGTCATAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118386761_1118386768 22 Left 1118386761 14:65262144-65262166 CCTCTTTATGACAGCACTAATCT No data
Right 1118386768 14:65262189-65262211 ATGACCTACTTACCTCCCAACGG 0: 5
1: 143
2: 711
3: 1505
4: 2798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118386761 Original CRISPR AGATTAGTGCTGTCATAAAG AGG (reversed) Intergenic
No off target data available for this crispr