ID: 1118387780

View in Genome Browser
Species Human (GRCh38)
Location 14:65270777-65270799
Sequence CCAGGTGACAAAAGGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118387773_1118387780 -1 Left 1118387773 14:65270755-65270777 CCTGATTTCTCCAGAAAGCAACC No data
Right 1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118387780 Original CRISPR CCAGGTGACAAAAGGGAAGA CGG Intergenic
No off target data available for this crispr