ID: 1118388803

View in Genome Browser
Species Human (GRCh38)
Location 14:65279711-65279733
Sequence CAGCCCTCAGGCCGTGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118388799_1118388803 -6 Left 1118388799 14:65279694-65279716 CCAGGCGCGGGACCCGGCAGCCC 0: 1
1: 0
2: 1
3: 18
4: 226
Right 1118388803 14:65279711-65279733 CAGCCCTCAGGCCGTGAACTCGG 0: 1
1: 0
2: 3
3: 7
4: 110
1118388791_1118388803 27 Left 1118388791 14:65279661-65279683 CCACAAGGGGCTGAAGACCGACA 0: 1
1: 1
2: 0
3: 6
4: 86
Right 1118388803 14:65279711-65279733 CAGCCCTCAGGCCGTGAACTCGG 0: 1
1: 0
2: 3
3: 7
4: 110
1118388798_1118388803 -2 Left 1118388798 14:65279690-65279712 CCAACCAGGCGCGGGACCCGGCA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1118388803 14:65279711-65279733 CAGCCCTCAGGCCGTGAACTCGG 0: 1
1: 0
2: 3
3: 7
4: 110
1118388797_1118388803 -1 Left 1118388797 14:65279689-65279711 CCCAACCAGGCGCGGGACCCGGC 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1118388803 14:65279711-65279733 CAGCCCTCAGGCCGTGAACTCGG 0: 1
1: 0
2: 3
3: 7
4: 110
1118388793_1118388803 10 Left 1118388793 14:65279678-65279700 CCGACAGCTCTCCCAACCAGGCG No data
Right 1118388803 14:65279711-65279733 CAGCCCTCAGGCCGTGAACTCGG 0: 1
1: 0
2: 3
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118388803 Original CRISPR CAGCCCTCAGGCCGTGAACT CGG Intergenic
901181578 1:7345708-7345730 CAGCCCTGATGTCGTTAACTGGG - Intronic
902634122 1:17724067-17724089 CAGCCCACTGGCCTTGACCTTGG + Intergenic
903943762 1:26949255-26949277 CAGCCTGCAGGCAGTGGACTGGG + Intergenic
903971117 1:27119399-27119421 CAGTCCTCAGGCCTGGAAGTAGG - Intronic
904326269 1:29728644-29728666 CAACTATCAGGCCCTGAACTAGG + Intergenic
904349320 1:29894586-29894608 AAGCCCTGAGGCCCAGAACTGGG + Intergenic
904436660 1:30503043-30503065 CCGTCCTCAGGCAGTGAGCTGGG + Intergenic
906154503 1:43606168-43606190 CAGCCCTGAGGCTGTGGCCTGGG - Intronic
910322850 1:85968279-85968301 CAACCCCCAGGCCATGGACTGGG - Intronic
920297983 1:204971045-204971067 CAGTCCCCAGGCCATCAACTGGG - Intronic
921272672 1:213486886-213486908 CAGCTCTCTGGCCTTGAAATTGG + Intergenic
923084243 1:230690323-230690345 CAGCCCACAGGCCGTCCACAAGG - Intronic
923119658 1:230978587-230978609 CAGCCCGCAGTCCGGGGACTGGG - Exonic
1063609756 10:7552559-7552581 CAGCCCTCAGGCTATGACTTAGG - Intergenic
1074112383 10:110431762-110431784 CAACCCTCAGGCTCTGAAGTGGG - Intergenic
1076879938 10:133235350-133235372 CTGTCCTCAGGCCCTGGACTCGG + Intergenic
1077146348 11:1047953-1047975 AAACCCTCAGGCGGTGACCTGGG + Intergenic
1077213221 11:1383021-1383043 CAGCTCTCAGGCGGTGAAGGGGG + Intergenic
1079114766 11:17634191-17634213 CAGCTCTCAGGGCGGGGACTGGG - Exonic
1079125847 11:17718372-17718394 AAGCCCTCAGGCGGTGATGTAGG - Intergenic
1081617559 11:44599801-44599823 AAGCTCCCAGGCCCTGAACTGGG + Intronic
1083764750 11:64836417-64836439 CAGCCCTCACCCGGTGAAGTCGG + Exonic
1083933187 11:65857231-65857253 CAGCCCTCGGGCCGTATACAGGG + Intronic
1085388417 11:76170108-76170130 CAGCCCTGAGGGAGTGACCTTGG - Intergenic
1091083490 11:132695650-132695672 CAGCCAGCAGGACCTGAACTTGG + Intronic
1095180727 12:39144715-39144737 CAGCCCCCTGGCCGCGAACTGGG + Intergenic
1095672227 12:44875597-44875619 CAGCCCTCCGACCCTGGACTAGG + Intronic
1096521119 12:52185335-52185357 CAGCCCTCAGGCCTTGCTCATGG + Intronic
1096776896 12:53969833-53969855 CATCCCACAGACCATGAACTGGG - Intergenic
1104275079 12:127319666-127319688 CAGCCCTCATGCCTAGGACTGGG - Intergenic
1104307717 12:127624437-127624459 CAGCCCTCACGCCTAGGACTGGG + Intergenic
1104816664 12:131650138-131650160 CAGCTCACTGGCCGTGATCTTGG + Intergenic
1113799102 13:113077346-113077368 CGGCCCTCAGGCCCTGAACTGGG - Intronic
1118388803 14:65279711-65279733 CAGCCCTCAGGCCGTGAACTCGG + Intergenic
1121589572 14:95092994-95093016 CAGCTGGCAGGGCGTGAACTCGG + Intronic
1122913079 14:104843284-104843306 CGGCCCCCAGGCCTAGAACTTGG - Intergenic
1124240992 15:28027472-28027494 CACCCCTCAGGCTGTGCGCTGGG + Intronic
1124694619 15:31853608-31853630 CAGGCCTCAGCCTGTGGACTCGG + Intronic
1124700339 15:31907058-31907080 CAGGTCACAGGCCGTGAACTGGG - Intergenic
1127216060 15:56824162-56824184 CCGCCCTCAGACCTTGTACTTGG - Intronic
1128222220 15:65977383-65977405 CAGGCCACAGGCCGGGAAGTGGG + Intronic
1131215062 15:90529805-90529827 CAGCCCTCAGCCCGCGAGCGTGG + Intergenic
1132608702 16:804465-804487 CAGTCCTCAGGCCAGGAGCTAGG - Intergenic
1132731545 16:1364895-1364917 CAGGGGTCAGGCAGTGAACTGGG - Intronic
1141558424 16:84851380-84851402 CAAACCTCAGGCCATGAACTGGG - Intronic
1141784801 16:86191909-86191931 CAGCCCTCAGTCTGTGATTTCGG + Intergenic
1142153329 16:88522215-88522237 CAGGCCTCAGGCCCTCACCTGGG + Intronic
1142376136 16:89708037-89708059 CAGCACCCAGGTCCTGAACTGGG - Intronic
1142869226 17:2809549-2809571 CAGGCCTCTGGCCATGCACTTGG + Intronic
1145973392 17:28970075-28970097 GAGCCCCCAGGCCCTGAGCTGGG + Intronic
1148541459 17:48483844-48483866 CAGCCCTCAGGTGGAGATCTTGG - Intergenic
1151852227 17:76697794-76697816 CAGCCTGCAGGGCGTGAGCTTGG - Intronic
1157128718 18:44982862-44982884 CTGCCCTCAGGCCAGGGACTGGG - Intronic
1163129478 19:15263699-15263721 CAGCCCTGAGGCTGAGAACTGGG - Intronic
1164611695 19:29636755-29636777 CATCCCTCAGCCCCTGACCTGGG - Intergenic
1164835106 19:31350859-31350881 CAGCTCTCAGGCCGGGAATGGGG + Intergenic
1165060002 19:33200568-33200590 GAGCCCTGAGGTCCTGAACTGGG - Intronic
1165092863 19:33395854-33395876 CAGCCCTCAGGGCCTGCCCTGGG - Intronic
1166324111 19:42038611-42038633 CAGCCCTCCAGCTGGGAACTTGG - Intronic
1166411694 19:42559945-42559967 CAGCCCCCAGGCCCTCATCTGGG - Intronic
927245039 2:20950826-20950848 CAGCAGTCAGGCCGTGAACTGGG + Intergenic
929864877 2:45709321-45709343 CAGCCCTCTGGCCTTGACCCAGG - Intronic
932604660 2:73157021-73157043 TACCCCTCAGGCTGTGAGCTAGG - Intergenic
932708629 2:74046632-74046654 CAGCCCTCAGGCCCTGGCCGGGG - Exonic
937260590 2:120584559-120584581 CAGCCCACAGTCCATGAGCTGGG - Intergenic
947202113 2:227623052-227623074 CACCCATCAGCCAGTGAACTGGG - Intronic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1172791522 20:37509165-37509187 CAGCCCCCAGAAGGTGAACTTGG - Intronic
1174136404 20:48382985-48383007 CAGCTCTCAGGCCATCACCTGGG - Intergenic
1175949970 20:62578172-62578194 CAGCCCTCAGGCTGTGGAGTTGG - Intergenic
1176525386 21:7862669-7862691 CACACCTCATGCCTTGAACTTGG - Intergenic
1176861534 21:14013902-14013924 CTGGCCTCAGGCCTTAAACTGGG - Intergenic
1178659406 21:34492682-34492704 CACACCTCATGCCTTGAACTTGG - Intergenic
1179908947 21:44438002-44438024 CAGCCACCAGGCCGTGAGCTCGG - Intronic
1179951325 21:44710343-44710365 CAGCCCTCGGGCTGTGCAGTGGG - Intronic
1180954958 22:19737456-19737478 CACCCCCCAGGCTGTGTACTGGG - Intergenic
1181697899 22:24603039-24603061 CATCCCTGAGGCTGTGATCTGGG - Intronic
1183295409 22:37026520-37026542 CAGGCCTCAGGCTGTGGAGTGGG - Intronic
1183613352 22:38926251-38926273 CAGCTCTCAGGAAGGGAACTGGG - Intergenic
1184664156 22:45978618-45978640 CAGCTTCCAGGCCGTGAAATGGG - Intergenic
1185181136 22:49364081-49364103 GAGGCCTCAGCCCGTGAACGGGG + Intergenic
1185366682 22:50440085-50440107 CTGGCCTCAGGCCTTAAACTGGG - Intronic
951006350 3:17620074-17620096 CAGCCCCCATGCAGGGAACTGGG + Intronic
957268279 3:77995983-77996005 CAGCCCTCAGATCCTAAACTTGG - Intergenic
961443582 3:126967275-126967297 AAGCCCTAAGGCCCTGAGCTTGG - Intergenic
965971228 3:174558754-174558776 CAACCCTCAGGCCATGGACCAGG - Intronic
965991541 3:174825286-174825308 CAGGCCTTAGGCCTTGGACTGGG - Intronic
966759787 3:183407742-183407764 AAGCCCGCAGGCTGTGAAATGGG - Intronic
969106564 4:4811050-4811072 CAGTGCTCAGGGCCTGAACTTGG + Intergenic
969396253 4:6923566-6923588 CAGCCTCCAGTCCGTGGACTCGG + Exonic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
975817394 4:78233064-78233086 CAGCCCTCAGTCGCTGGACTTGG - Intronic
980618570 4:135267262-135267284 CACCCCTCAGCCCGTCATCTAGG + Intergenic
984852649 4:184167701-184167723 CTGGCCCGAGGCCGTGAACTTGG - Intronic
986739066 5:10689828-10689850 CAGCCCTCAGGGTGTGCACAAGG - Intronic
991245310 5:64503858-64503880 CAGCTCTCAGGCCCAGACCTTGG - Intergenic
992895113 5:81239087-81239109 CTGTACACAGGCCGTGAACTGGG + Intronic
1002319725 5:178367846-178367868 CACCCTTCAGGCCGTGGCCTGGG + Intronic
1002862710 6:1094378-1094400 CAGCCCACAGAAAGTGAACTGGG + Intergenic
1015819619 6:137246370-137246392 CAGTCCCCAGGCCGTGGACCAGG - Intergenic
1016306954 6:142694763-142694785 CAGCCCTAGGGAAGTGAACTAGG - Intergenic
1016990617 6:149925629-149925651 CAGCACTCAGGCCCGGAGCTCGG - Intergenic
1030198608 7:106878538-106878560 CAGCCCCCAGGCAGTAATCTGGG + Intronic
1034546889 7:151795043-151795065 CTGCCCTGGGGCCCTGAACTAGG - Intronic
1034885302 7:154794284-154794306 CAGCCCTCGGGCCTGGGACTTGG + Intronic
1035178507 7:157072110-157072132 CAGTCCTCAGGCCCTGCAGTGGG + Intergenic
1035296294 7:157868598-157868620 CAGTCCTCAGGCTGGGAAATGGG - Intronic
1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG + Intergenic
1041019786 8:53627192-53627214 CTTCCCACATGCCGTGAACTGGG + Intergenic
1044552190 8:93524800-93524822 ATGCCCTCTGGCCGTGATCTTGG + Intergenic
1049378354 8:142300220-142300242 CAGCCCTCTGGCCAGGAGCTGGG - Intronic
1049404211 8:142444415-142444437 CATGACTCAGGCCCTGAACTGGG + Intergenic
1049493365 8:142916669-142916691 CAGCACTCAGCCTGTGACCTGGG + Intronic
1058222987 9:102325746-102325768 CAGCAGTGAGGCCCTGAACTTGG - Intergenic
1060526281 9:124323083-124323105 CAGCCCTCATGCCAAGAACTAGG + Intronic
1060828830 9:126701352-126701374 CAGCCACCAGGCTGAGAACTGGG + Intergenic
1061401315 9:130369927-130369949 CGGCCCTCAGGCTGTGATCCTGG + Intronic
1062350781 9:136137681-136137703 CAGCCATCAGGCAGAGACCTGGG + Intergenic
1062530145 9:136996143-136996165 CAGCTCTCAGGTCGGGGACTGGG - Intronic
1198035779 X:132800073-132800095 CAACCCTCAGGCCATGGACCGGG + Intronic