ID: 1118389008

View in Genome Browser
Species Human (GRCh38)
Location 14:65280814-65280836
Sequence TGCAGCTGCCCCGCGAGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 239}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118389002_1118389008 6 Left 1118389002 14:65280785-65280807 CCGTATCACGCCCTTGAAGCACC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG 0: 1
1: 0
2: 4
3: 14
4: 239
1118389003_1118389008 -4 Left 1118389003 14:65280795-65280817 CCCTTGAAGCACCAGAACGTGCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG 0: 1
1: 0
2: 4
3: 14
4: 239
1118389004_1118389008 -5 Left 1118389004 14:65280796-65280818 CCTTGAAGCACCAGAACGTGCAG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG 0: 1
1: 0
2: 4
3: 14
4: 239
1118388999_1118389008 22 Left 1118388999 14:65280769-65280791 CCCATCCGCATCTCATCCGTATC 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG 0: 1
1: 0
2: 4
3: 14
4: 239
1118389001_1118389008 17 Left 1118389001 14:65280774-65280796 CCGCATCTCATCCGTATCACGCC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG 0: 1
1: 0
2: 4
3: 14
4: 239
1118389000_1118389008 21 Left 1118389000 14:65280770-65280792 CCATCCGCATCTCATCCGTATCA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG 0: 1
1: 0
2: 4
3: 14
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118389008 Original CRISPR TGCAGCTGCCCCGCGAGGGC CGG Intergenic
900269325 1:1778894-1778916 TGCAGGTGCCCCGCGAGAGCTGG + Intronic
900398515 1:2463202-2463224 TGCAGCTCCCCCTCCGGGGCTGG - Intronic
900609757 1:3539544-3539566 TGCGGATGCCTCGGGAGGGCAGG - Intronic
901086689 1:6615069-6615091 GGCGGCTGCCGCGGGAGGGCGGG + Intronic
901519287 1:9770485-9770507 GGCAGCTGTCCCGCCTGGGCTGG + Intronic
901763060 1:11483050-11483072 TGCAGCTGCCCAACAAAGGCCGG + Intronic
901936473 1:12630442-12630464 TGCATCTGTCCCCAGAGGGCAGG - Intergenic
902617013 1:17629461-17629483 GGCAGCTGCCACTCGGGGGCTGG - Intronic
904263380 1:29303938-29303960 TGCAGCTGCCCCGTGTGGTATGG - Exonic
904863563 1:33558923-33558945 TGCAGCTGCTCCACGAGATCAGG - Intronic
907767275 1:57423864-57423886 CGCAGGTGCCCCGCGAGGACAGG - Intronic
911025976 1:93435545-93435567 TGCAGGTGCACCTGGAGGGCAGG + Intergenic
911725202 1:101235970-101235992 TGCAGCTGCCCAGCAGGAGCCGG - Intergenic
913042526 1:115041242-115041264 TGCAGCAGCCACGAGAGTGCTGG + Intergenic
913075453 1:115337798-115337820 GGCAGCTGGCGCGCCAGGGCGGG - Intronic
914824765 1:151132796-151132818 TGGACGTGCCCCCCGAGGGCAGG - Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924381557 1:243470214-243470236 TCCAGCTGCCCCGACGGGGCTGG + Intronic
924754778 1:246931456-246931478 GGCTTCTGCCCCGCGAGCGCCGG - Intronic
1063367709 10:5501064-5501086 AGCAGCTGCCACACTAGGGCTGG - Intergenic
1067663143 10:48251360-48251382 TGGAGCTGCACTGGGAGGGCAGG - Intronic
1069589915 10:69635256-69635278 TGCAGCCGCCCGGTGAGGCCTGG - Intergenic
1072615365 10:97046118-97046140 TCCATCTGCCCCAGGAGGGCTGG - Intronic
1073147816 10:101292066-101292088 AGGCGCTGCCCCGCGGGGGCGGG - Intergenic
1077058606 11:607986-608008 GGCAGCAGCCCCGAGAGGTCTGG + Exonic
1077130686 11:970873-970895 TGCACCAGCCCGGCAAGGGCTGG - Intronic
1077173371 11:1178224-1178246 TGCAGCTGAGCACCGAGGGCCGG - Intronic
1077214372 11:1389299-1389321 TGCAGCACCCCCTCGAGGGGCGG + Intergenic
1077237487 11:1488681-1488703 TGCCACTGTCCCGAGAGGGCTGG + Intronic
1077409094 11:2395245-2395267 CTCAGCTGCCCCGGGAGTGCTGG - Intronic
1077418388 11:2436557-2436579 GGCAGGGGCCCCGCCAGGGCTGG + Intergenic
1079504102 11:21133854-21133876 TGCAGCTGCACCTGGAGGGTGGG + Intronic
1079882442 11:25944303-25944325 TGCAGCTGCAGCTGGAGGGCGGG - Intergenic
1080448485 11:32358985-32359007 TGCAGCCGCTCCGTCAGGGCTGG + Intergenic
1081639946 11:44746161-44746183 AGCAGCTGCCCCCCGTGGGTGGG + Intronic
1083839728 11:65297380-65297402 TGCAGCTGCCCCTCCCTGGCTGG - Exonic
1084385502 11:68841074-68841096 GACGGCTGCACCGCGAGGGCGGG + Intronic
1084425321 11:69081130-69081152 TGCAGCCTTCCCGCAAGGGCTGG + Intronic
1084669500 11:70596686-70596708 TGCAGCAGCCCAGGGAAGGCAGG - Intronic
1084725441 11:70938876-70938898 TGCAGCTGCCCCGCTAAGAAGGG - Intronic
1089075590 11:115736029-115736051 TGCTGCTGCCGTGTGAGGGCTGG + Intergenic
1089108169 11:116032488-116032510 GGCAGCTGCCAGGTGAGGGCTGG + Intergenic
1089555755 11:119315319-119315341 TGCAGCAGCGCTGCGAGGGGAGG - Intronic
1090240964 11:125181580-125181602 ACCAGCTGCCCAGTGAGGGCTGG + Intronic
1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG + Intronic
1092670251 12:10854033-10854055 TGCAGCTGTGCTGCTAGGGCAGG - Intronic
1097080251 12:56425028-56425050 TGTAGCTGCTCAGCCAGGGCTGG + Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1102072687 12:110034904-110034926 AGCAGCAGCCCTGTGAGGGCAGG - Intronic
1102683141 12:114704105-114704127 TGCTGCTGCCCAAGGAGGGCTGG + Intergenic
1103409504 12:120700800-120700822 ATCAGCTGCCTAGCGAGGGCAGG + Exonic
1103524628 12:121559475-121559497 TCCTGCTGCCCCGTGGGGGCTGG - Intronic
1103924068 12:124414063-124414085 TGCAGGAGCCCTGCGAGGGCAGG - Intronic
1104947599 12:132423557-132423579 AGCAGCGGCCCCGGGAGGGCGGG + Intergenic
1105821578 13:24085497-24085519 TGCAGCTGTCCCCACAGGGCAGG - Intronic
1105891419 13:24685136-24685158 GGCAGCTGCCCAGCGAAGGATGG - Intronic
1108106384 13:47014885-47014907 AGCAGCTGCCCCCATAGGGCTGG - Intergenic
1108618525 13:52159243-52159265 TGCAGTTGCCCCGCGGGCGCCGG - Intronic
1108707843 13:53006274-53006296 TGCAGCTCCCCAGGTAGGGCAGG + Intergenic
1112185698 13:97126024-97126046 TTCATCAGCCCCGCGAGGGGAGG - Intergenic
1115331602 14:32203672-32203694 TGCTGCGGCACCGAGAGGGCCGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG + Intergenic
1119318432 14:73714438-73714460 AGCAGCTCCGCCGCGGGGGCGGG - Intergenic
1121101575 14:91253583-91253605 CGGAGCGGCCCCGCGAGCGCGGG - Intronic
1121245646 14:92459354-92459376 TGCAGCTGTCTTGCAAGGGCTGG + Intronic
1121492729 14:94371742-94371764 TGTAGCTGCCCCCTGAGGGAAGG + Intergenic
1121570816 14:94945285-94945307 TGCAGCAGCTCAGCCAGGGCAGG - Intergenic
1122888082 14:104719417-104719439 GCCAGCTGCCCAGCGTGGGCAGG + Exonic
1122905821 14:104800987-104801009 AGCAGCTCCGCCGCGGGGGCGGG - Exonic
1202877668 14_KI270722v1_random:21660-21682 TGTAGTTGCCCTGGGAGGGCGGG - Intergenic
1123995283 15:25713825-25713847 TGGAGCTGCCCCACCTGGGCAGG - Exonic
1125484612 15:40103539-40103561 GGCACCAGCCCCGCCAGGGCGGG - Intronic
1127922696 15:63505203-63505225 TGCGGCCGCCCCTCGGGGGCCGG - Intronic
1131271422 15:90949781-90949803 AGCAGCTGCCACGCCAGAGCTGG + Intronic
1131749919 15:95495340-95495362 TGCAGCGGCCCTGCCAGGGGTGG - Intergenic
1132462221 16:61321-61343 TGGAGGTGCCCGGCGGGGGCAGG - Intronic
1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG + Intronic
1132977193 16:2716677-2716699 TGCAGTTTCCCCCCCAGGGCTGG + Intronic
1132996898 16:2828137-2828159 TGCTCCTGCCCCGTCAGGGCTGG + Intergenic
1133056168 16:3146399-3146421 TGCGGCTTCCCCACGAGGGCAGG + Intronic
1133248764 16:4466392-4466414 AGCAGCTTCCCCTGGAGGGCAGG + Exonic
1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG + Intronic
1135298326 16:21301943-21301965 TGCAGCTGCTCCCCGACGCCCGG + Intronic
1138589905 16:57994012-57994034 TGCAGCTGGGCCACGGGGGCAGG + Intergenic
1139636949 16:68263891-68263913 TGCAGCTCCCCCAAGAGGGGGGG + Intergenic
1139636959 16:68263921-68263943 TGCAGCTCCCCCAAGAGGGGTGG + Intergenic
1139894891 16:70280603-70280625 TGCAGATGCCCCGGGGGAGCAGG + Intronic
1141533945 16:84665979-84666001 TGCAGCTGCCCCTCCAGGTTTGG - Intronic
1142194498 16:88733197-88733219 GGCAGCTGCCCCAGGAGGGTCGG + Intronic
1142220887 16:88854427-88854449 TGCAGCTGCCAGGACAGGGCAGG - Intronic
1142243254 16:88956655-88956677 TGCAGCTGCCCCACCTGGCCTGG + Intronic
1142276809 16:89123139-89123161 TACAGCTGCCCTGCGGGGCCTGG + Intronic
1142296973 16:89230502-89230524 AGCAGCTGCCCCAGGAGTGCCGG - Exonic
1142356989 16:89605951-89605973 AGCAGCTGCCCGGCCTGGGCTGG + Intergenic
1142858869 17:2749314-2749336 TCCAGCTCCCCCGGGAGGGCTGG - Intergenic
1143586657 17:7853867-7853889 TGCATCTGCGCCGGGCGGGCGGG - Exonic
1145959663 17:28880021-28880043 TGCTGCTGCCCCTCTAGGTCTGG - Exonic
1146832446 17:36081687-36081709 TGCTGGTGCCAGGCGAGGGCTGG - Intergenic
1147341735 17:39756445-39756467 GGCAACTGCCACCCGAGGGCAGG - Intergenic
1147450213 17:40499705-40499727 CTCAGCTGTCCCGGGAGGGCGGG - Intronic
1147999612 17:44380104-44380126 GGCAGAAGCCCCGCCAGGGCCGG - Exonic
1150108219 17:62478004-62478026 GGCAGCATCCCCGCGGGGGCGGG + Intronic
1151802142 17:76384854-76384876 TCCCGGGGCCCCGCGAGGGCGGG - Exonic
1152542212 17:80982076-80982098 TGCAGGTGCCCCGCGTCGGTGGG - Intergenic
1152729201 17:81961479-81961501 TCCAGCTGCCCCGCGGGGGGGGG - Intronic
1152757542 17:82093189-82093211 TGCGGCTGCGCGGCCAGGGCAGG - Intronic
1159519188 18:69496130-69496152 TGCAGCTGCCCCAGGAGGGCAGG + Intronic
1159931386 18:74315950-74315972 AGCAGCTGCCCCCCAAGGCCAGG - Exonic
1160528131 18:79549042-79549064 TGCAGCGTCCACTCGAGGGCAGG + Intergenic
1160755096 19:752827-752849 TGGAGCTCCCCGGGGAGGGCGGG - Intronic
1160904191 19:1444919-1444941 GGCAGCTGACCCGCAAGCGCCGG - Intergenic
1161073815 19:2275468-2275490 TGCAGCTGCCCCTCCAGGGCTGG - Exonic
1162430469 19:10625465-10625487 GGCAGCTGCCCAGCTCGGGCCGG + Exonic
1162811111 19:13164695-13164717 TGCAGCTGCACCCCGAGGAAAGG - Intergenic
1163665966 19:18604239-18604261 TGCAGCTGCCCTCCCGGGGCTGG + Intronic
1163830332 19:19544493-19544515 TGCAGCTGCTCCGCGGAGCCGGG - Exonic
1164989299 19:32673165-32673187 GGCAGCTTCCCTGGGAGGGCAGG - Intronic
1166702723 19:44891473-44891495 GGCGGCAGCCCCACGAGGGCCGG - Exonic
1166887970 19:45973180-45973202 TGCACCTGCCACGGGAGGGGGGG + Intronic
1167096027 19:47375536-47375558 TGCAGCAGCGCCGGGAGCGCCGG + Exonic
1202673010 1_KI270710v1_random:11284-11306 TGTAGTTGCCCTGGGAGGGCGGG + Intergenic
925128336 2:1477266-1477288 CGCAGCTGCCTCTCTAGGGCCGG - Exonic
925990354 2:9249735-9249757 TGCAGCTCCCCCGCCAGCCCGGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
932314071 2:70768061-70768083 TGCAGCGGCTCCGCGGCGGCGGG + Exonic
932495554 2:72144254-72144276 TGCAGAGGGCCCGCGAGGGAGGG + Intronic
932612459 2:73210005-73210027 TGCAGCGGCCCCGGGAGAGCTGG - Intronic
938051660 2:128178353-128178375 TGCAGCTCACCCGCTAGGGAAGG + Intronic
938539648 2:132275585-132275607 ACCAGATGCCCCGCGTGGGCCGG - Intergenic
941918824 2:170829410-170829432 TGCAGCTGACCCTCAGGGGCTGG + Intronic
941986412 2:171515807-171515829 TCCACCTGCCCCACGTGGGCAGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
945245163 2:207711362-207711384 GGCAGCTGCCAGGCGGGGGCGGG + Intergenic
946415568 2:219538243-219538265 GGCTGGTGCCCCGGGAGGGCTGG + Exonic
946428816 2:219613877-219613899 TGCTGCTGCCCCGAGATGCCAGG + Exonic
946596114 2:221307790-221307812 TGCATCTGCCCCTCCAAGGCTGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948568001 2:238898607-238898629 TGCAGCTGCCCCGAGGGGGCTGG + Intronic
948851847 2:240712134-240712156 TGCTGCCGTCCAGCGAGGGCTGG - Intergenic
1170578626 20:17681984-17682006 TGCAGCGGCCGCGCGCGGGCCGG - Intronic
1171367293 20:24633914-24633936 TGCAGGTGACCTGGGAGGGCAGG - Intronic
1171989510 20:31684894-31684916 TGCAGCTGCCAAGGGAAGGCTGG + Intronic
1172633946 20:36396816-36396838 TGCAACCGCCCTGAGAGGGCAGG - Intronic
1173565775 20:44037399-44037421 CACAGCTGCCCCATGAGGGCAGG + Intronic
1174346912 20:49936759-49936781 AGCAGCTGCCCCGCTAAGACGGG - Intronic
1174565139 20:51459056-51459078 TGAAGCAGACCCGTGAGGGCAGG - Intronic
1175108047 20:56628507-56628529 TGCAGCTGCCTCTGGCGGGCCGG - Intergenic
1175717053 20:61262185-61262207 TGCAGCTGGCCAGCCGGGGCGGG + Intronic
1175828665 20:61950679-61950701 TGCTGCTGCCCAGCAGGGGCCGG - Intergenic
1176102303 20:63370099-63370121 TGACACTGCCCCGGGAGGGCAGG - Intronic
1176234443 20:64047950-64047972 CGCAGGGGCCCCCCGAGGGCAGG + Exonic
1176638954 21:9279096-9279118 TGTAGTTGCCCTGGGAGGGCGGG - Intergenic
1178931167 21:36820352-36820374 TGCTGCTGCCCAGCCACGGCCGG + Intronic
1179248081 21:39650347-39650369 TGCAGCTGACCAGTGAAGGCAGG - Intronic
1179641356 21:42749453-42749475 AGCAGCTGCCCCAGGAGGTCTGG - Intronic
1179885884 21:44314139-44314161 TGCAGGTGCCCCTTGGGGGCGGG + Intronic
1180372262 22:12051938-12051960 TGTAGTTGCCCTGGGAGGGCGGG - Intergenic
1180390211 22:12223716-12223738 TGTAGTTGCCCTGGGAGGGCAGG + Intergenic
1180415723 22:12710751-12710773 TGTAGTTGCCCTGGGAGGGCAGG - Intergenic
1180422999 22:12886603-12886625 TGTAGTTGCCCTGGGAGGGCGGG - Intergenic
1180979968 22:19873817-19873839 GGCAGCTGCACAGCCAGGGCAGG - Intergenic
1184405378 22:44297944-44297966 TGCAGCAGCCCCGGGTGGGTAGG - Intronic
1185045643 22:48527473-48527495 TGCAGCTGCCCAGAGACAGCCGG + Intronic
1185344641 22:50305954-50305976 TGCAGCTGCCCAGACTGGGCGGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950214573 3:11150366-11150388 TGCAGCCGCCCCAAGTGGGCAGG - Intronic
950426746 3:12928443-12928465 TGCAGCTGGACAGCCAGGGCCGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954248831 3:49352864-49352886 TCCAGCTGCCCCGAGACTGCAGG + Intergenic
954410773 3:50369976-50369998 AGCAGCTGCCTGGCGAGGGGTGG + Intronic
954733440 3:52685477-52685499 TGAAGCTGCCCCGCGACGAGCGG + Intronic
955856458 3:63278395-63278417 TGGAGCAGCCCGGCGAGGGCAGG - Exonic
957101902 3:75837981-75838003 TGTAGTTGCCCTGGGAGGGCGGG + Intergenic
957653230 3:83035732-83035754 TGCAGCTGCCCAGCCATTGCTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960959825 3:123062431-123062453 AGCAGCAGCCCCGCGGGGCCAGG - Intergenic
963264458 3:143227128-143227150 TGCAGCTGCCCCTGGAAGGGCGG + Intergenic
963483249 3:145903855-145903877 TGCAGCTGCACGGGCAGGGCCGG - Intergenic
968081470 3:195849518-195849540 TGGGGCTGCCCCGGGAGGCCCGG - Intergenic
1202747941 3_GL000221v1_random:125923-125945 TGTAGTTGCCCTGGGAGGGCGGG + Intergenic
968500812 4:949053-949075 AGCAGCTGCCCCCCTAGGGAGGG - Intronic
969360954 4:6663652-6663674 TGCAGCTGCCCCAGGAAGGATGG + Intergenic
969445723 4:7243793-7243815 GGTAGCTTCCCTGCGAGGGCAGG + Intronic
978617408 4:110611298-110611320 TGGAGCTGCCTCTCGAGGCCCGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982918970 4:161250178-161250200 TGCAGCTGCCCAGTGACAGCTGG - Intergenic
984758138 4:183342779-183342801 TGCCGCTGCACCGCCAGGTCTGG + Intergenic
984820346 4:183876332-183876354 TGCAGCAGGCCCGGGAGGCCTGG + Intronic
1202753846 4_GL000008v2_random:37506-37528 TGTAGTTGCCCTGGGAGGGCGGG - Intergenic
986016906 5:3765634-3765656 TGCAGCAGCCCAGCGAGGGAGGG + Intergenic
986330234 5:6712528-6712550 TCCAGCTGCACCGAGCGGGCAGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
998132794 5:139659723-139659745 AGCTGCTGCCCCGCCTGGGCTGG + Intronic
1001656705 5:173356265-173356287 TGCTGCTGCCCTGCCTGGGCCGG + Intergenic
1002043660 5:176530680-176530702 TGAAGCTGCCCAGGGAGGGCTGG + Exonic
1002887826 6:1312043-1312065 TGCGGCGGCTCCGCGGGGGCGGG - Intergenic
1003236475 6:4299851-4299873 TTCAGCTGCCCAAGGAGGGCAGG - Intergenic
1003266931 6:4574164-4574186 TGCAACTACCCAGGGAGGGCTGG - Intergenic
1006299244 6:33185132-33185154 AGCACCTGTCCCCCGAGGGCAGG + Intronic
1006448109 6:34091120-34091142 TGCTGGTGCCCTGAGAGGGCTGG - Intronic
1007546780 6:42700378-42700400 TGAAGCTGCTCCCTGAGGGCAGG + Intronic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1008816904 6:55579197-55579219 TGCGGCGGCGCCGAGAGGGCGGG + Intronic
1013225560 6:108117762-108117784 CGCCGCTGCCCCGCGCGGCCGGG - Intronic
1016190612 6:141260813-141260835 TGCAGCTGCACCTGGATGGCAGG - Intergenic
1016982354 6:149864493-149864515 CGCCGCTGCCCAGCTAGGGCAGG + Intergenic
1017054388 6:150424463-150424485 TGCAGCTGCACCCTGAGGGGTGG - Intergenic
1019402225 7:861960-861982 TGCATCTGCCCCAAGAGGTCTGG - Intronic
1019554045 7:1619834-1619856 TGCAGGTGGCCAGGGAGGGCTGG - Intergenic
1020812589 7:12864654-12864676 TGCAGTGGCCCCTAGAGGGCTGG + Intergenic
1025150203 7:56541453-56541475 TGGAGCTGCCCCTCCTGGGCTGG + Intergenic
1025239089 7:57256685-57256707 TGGAGCTGTCCCGGGAGGGCTGG + Intergenic
1025254321 7:57373173-57373195 TGCAGCTGCCCCACCAGGTGGGG + Intergenic
1025991855 7:66503238-66503260 TGCACCAGCCCCGCCAGGGGTGG + Intergenic
1027924736 7:84446938-84446960 TGCAGCTGCCCAGCCACAGCTGG + Intronic
1029113328 7:98224272-98224294 TGCAGGTGCACGGCGTGGGCAGG - Intronic
1033253015 7:139777336-139777358 GGCGGCTGCCCGGGGAGGGCAGG - Intronic
1034276435 7:149825904-149825926 TCCAGCTGCACCGCCTGGGCCGG - Intergenic
1034298175 7:149992541-149992563 TGCAGCTGCCCCGGACGGGAAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034807840 7:154104242-154104264 TGCAGCTGCCCCGGACGGGAAGG + Intronic
1035048769 7:155986162-155986184 TCCAGCTGCCCAGCCAGGCCAGG + Intergenic
1036264812 8:7265557-7265579 TGCAGGTTCCCCGCGACAGCGGG + Intergenic
1036267414 8:7280801-7280823 TGCAGGTTCCCCGCGACAGCGGG + Intergenic
1036268716 8:7288423-7288445 TGCAGGTTCCCCGCGACAGCGGG + Intergenic
1036351337 8:8014299-8014321 TGCAGGTTCCCCGCGACAGCGGG - Intergenic
1037645292 8:20787381-20787403 TGCAGCTGCCCCTGGAGGATGGG - Intergenic
1038227495 8:25670532-25670554 TGCACCTGCCGCACGGGGGCTGG + Intergenic
1039881787 8:41629834-41629856 TGTAACTGCCCCGTGAGGCCAGG + Intergenic
1041449884 8:57994950-57994972 TGCAGCTTCCCCGCCCGGCCCGG + Intronic
1042611609 8:70607622-70607644 AGCGTCAGCCCCGCGAGGGCCGG - Intronic
1044474117 8:92606152-92606174 TGCAGCTCCCCCGCGCCAGCTGG - Intergenic
1044729569 8:95219184-95219206 TGCAGCTGACTCCTGAGGGCAGG - Intergenic
1047262514 8:123274903-123274925 CGCAGCAGCCCCCCGAGGGGCGG - Intronic
1049236676 8:141515599-141515621 TGGGGCTGGCCCTCGAGGGCAGG - Intronic
1049581203 8:143411869-143411891 TGGAGCTGCCCCGCAGGAGCAGG + Intergenic
1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG + Intronic
1049802213 8:144523108-144523130 TGCCCCAGCCTCGCGAGGGCCGG - Exonic
1056825748 9:89875216-89875238 TGCAGCGGCTCCCCGAGGCCTGG + Intergenic
1057198161 9:93126621-93126643 TGCAGCCGGCCCGCTGGGGCTGG - Exonic
1057772635 9:97982681-97982703 CCCAGCTGCCCTGCCAGGGCCGG + Intergenic
1059375218 9:113876128-113876150 GGCGGCGGCCCCGCGAGGGGCGG + Intergenic
1059597479 9:115737806-115737828 TGCAGCTGCCCTAGGAGGGCAGG - Intergenic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062425082 9:136502373-136502395 TGCTGCTGTCCCGCAAGCGCCGG - Exonic
1062481927 9:136756494-136756516 TGCAGTTGCCCTGTGATGGCAGG - Intronic
1062645581 9:137546549-137546571 TGAAGCTGCCCCTCCAGGCCAGG + Intronic
1203716578 Un_KI270742v1:156005-156027 TGTAGTTGCCCTGGGAGGGCGGG + Intergenic
1203534635 Un_KI270743v1:22230-22252 TGTAGTTGCCCTGGGAGGGCGGG - Intergenic
1203650807 Un_KI270751v1:119567-119589 TGTAGTTGCCCTGGGAGGGCGGG + Intergenic
1186447973 X:9648074-9648096 TGCAGCTGCCCCTAGAAGTCAGG + Intronic
1186485587 X:9932288-9932310 CAGAGCTGCCCCGGGAGGGCCGG + Exonic
1189354068 X:40298330-40298352 TGCAGCTGCCCTTAGAGGTCAGG - Intergenic
1192496311 X:71618410-71618432 TGCTGCTGCCCAGCCAGGCCAGG - Intronic
1197716035 X:129706623-129706645 TGCAGCTGGGCCCTGAGGGCTGG - Intergenic
1199552756 X:149076485-149076507 TGCAGCTGCCTCACCATGGCGGG - Intergenic