ID: 1118391305

View in Genome Browser
Species Human (GRCh38)
Location 14:65298114-65298136
Sequence CTGTGGAATAGGAGCCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118391305_1118391312 3 Left 1118391305 14:65298114-65298136 CCTTGGTGGCTCCTATTCCACAG No data
Right 1118391312 14:65298140-65298162 CCACGTGGATCTGCAAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118391305 Original CRISPR CTGTGGAATAGGAGCCACCA AGG (reversed) Intergenic
No off target data available for this crispr